EMAIL THIS PAGE TO A FRIEND

SUPT20HL1

suppressor of Ty 20 homolog (S. cerevisiae)-like 1

Synonyms: FAM48B1
UniProtKB ID: Q3ZLR7
Gene ID:
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301777 ANTI-FAM48B1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136234 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720340 Rosetta Predictions human pricing
XM_001721067 Rosetta Predictions human pricing
XM_001722227 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00436043 predicted 944
2 SASI_Hs02_00436044 predicted 220
3 SASI_Hs02_00436045 predicted 399
4 SASI_Hs02_00436046 predicted 1278
5 SASI_Hs02_00436047 predicted 1416
6 SASI_Hs02_00436048 predicted 701
7 SASI_Hs02_00436049 predicted 494
8 SASI_Hs02_00436050 predicted 615
9 SASI_Hs02_00436051 predicted 1129
10 SASI_Hs02_00436052 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00440570 predicted 952
2 SASI_Hs02_00440571 predicted 220
3 SASI_Hs02_00440572 predicted 405
4 SASI_Hs02_00440573 predicted 1285
5 SASI_Hs02_00440574 predicted 1416
6 SASI_Hs02_00440575 predicted 703
7 SASI_Hs02_00440576 predicted 490
8 SASI_Hs02_00440577 predicted 615
9 SASI_Hs02_00440578 predicted 1138
10 SASI_Hs02_00440579 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00447879 predicted 944
2 SASI_Hs02_00447880 predicted 220
3 SASI_Hs02_00447881 predicted 403
4 SASI_Hs02_00447882 predicted 1277
5 SASI_Hs02_00447883 predicted 1416
6 SASI_Hs02_00447884 predicted 699
7 SASI_Hs02_00447885 predicted 488
8 SASI_Hs02_00447886 predicted 617
9 SASI_Hs02_00447887 predicted 1132
10 SASI_Hs02_00447888 predicted 1093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136234
SUPT20HL1 MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 20 homolog (S. cerevisiae)-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-2490s21c1
Sequence:CCGGCTTGCAGCAGCCGCAGCATATCTCGAGATATGCTGCGGCTGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-1784s21c1
Sequence:CCGGTAGCGCCAGCCATTCAGTTGACTCGAGTCAACTGAATGGCTGGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-1686s21c1
Sequence:CCGGTTCTGCGGCACCAAGTCATTCCTCGAGGAATGACTTGGTGCCGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-28s21c1
Sequence:CCGGGATCGCGCAGAGAATATCATTCTCGAGAATGATATTCTCTGCGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-564s21c1
Sequence:CCGGGAGCCAGGAAGACAAGCTTCACTCGAGTGAAGCTTGTCTTCCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136234
SUPT20HL1 MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 20 homolog (S. cerevisiae)-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-2490s21c1
Sequence:CCGGCTTGCAGCAGCCGCAGCATATCTCGAGATATGCTGCGGCTGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-1784s21c1
Sequence:CCGGTAGCGCCAGCCATTCAGTTGACTCGAGTCAACTGAATGGCTGGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-1686s21c1
Sequence:CCGGTTCTGCGGCACCAAGTCATTCCTCGAGGAATGACTTGGTGCCGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-28s21c1
Sequence:CCGGGATCGCGCAGAGAATATCATTCTCGAGAATGATATTCTCTGCGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-564s21c1
Sequence:CCGGGAGCCAGGAAGACAAGCTTCACTCGAGTGAAGCTTGTCTTCCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136234
SUPT20HL1 MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 20 homolog (S. cerevisiae)-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-2490s21c1
Sequence:CCGGCTTGCAGCAGCCGCAGCATATCTCGAGATATGCTGCGGCTGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-1784s21c1
Sequence:CCGGTAGCGCCAGCCATTCAGTTGACTCGAGTCAACTGAATGGCTGGCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-1686s21c1
Sequence:CCGGTTCTGCGGCACCAAGTCATTCCTCGAGGAATGACTTGGTGCCGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-28s21c1
Sequence:CCGGGATCGCGCAGAGAATATCATTCTCGAGAATGATATTCTCTGCGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136234.1-564s21c1
Sequence:CCGGGAGCCAGGAAGACAAGCTTCACTCGAGTGAAGCTTGTCTTCCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks