EMAIL THIS PAGE TO A FRIEND

SUPT20HL2

suppressor of Ty 20 homolog (S. cerevisiae)-like 2

Synonyms: FAM48B1 FAM48B2
Species: Human SUPT20HL2(170067)
UniProtKB ID: P0C7V6
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_093087 Rosetta Predictions human pricing
XR_041479 Rosetta Predictions human pricing
XR_041480 Rosetta Predictions human pricing
XR_041481 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_093087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281209 predicted 1347
2 SASI_Hs01_00281210 predicted 623
3 SASI_Hs01_00281211 predicted 798
4 SASI_Hs01_00281212 predicted 1113
5 SASI_Hs01_00281213 predicted 1686
6 SASI_Hs01_00281214 predicted 1818
7 SASI_Hs01_00281215 predicted 1105
8 SASI_Hs01_00281216 predicted 892
9 SASI_Hs01_00281217 predicted 1019
10 SASI_Hs01_00281218 predicted 1537
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527715 predicted 1054
2 SASI_Hs02_00527716 predicted 1040
3 SASI_Hs02_00527717 predicted 274
4 SASI_Hs02_00527718 predicted 1473
5 SASI_Hs02_00527719 predicted 87
6 SASI_Hs02_00527720 predicted 2563
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527721 predicted 939
2 SASI_Hs02_00527722 predicted 926
3 SASI_Hs02_00527723 predicted 274
4 SASI_Hs02_00527724 predicted 1362
5 SASI_Hs02_00527725 predicted 89
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527726 predicted 1051
2 SASI_Hs02_00527727 predicted 1035
3 SASI_Hs02_00527728 predicted 272
4 SASI_Hs02_00527729 predicted 1476
5 SASI_Hs02_00527730 predicted 82
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136233
SUPT20HL2 MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 20 homolog (S. cerevisiae)-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-527s21c1
Sequence:CCGGCTGAGGTGAAGACGATGACAACTCGAGTTGTCATCGTCTTCACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-561s21c1
Sequence:CCGGATGGAGCCAGGAAGACAAATTCTCGAGAATTTGTCTTCCTGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-1002s21c1
Sequence:CCGGAGACCCTTTCAGACATGCATGCTCGAGCATGCATGTCTGAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-1608s21c1
Sequence:CCGGGCCCTCTGTGCCTCTTATTAACTCGAGTTAATAAGAGGCACAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-584s21c1
Sequence:CCGGCTCTTGAGAGTCAACTGATCTCTCGAGAGATCAGTTGACTCTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136233
SUPT20HL2 MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 20 homolog (S. cerevisiae)-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-527s21c1
Sequence:CCGGCTGAGGTGAAGACGATGACAACTCGAGTTGTCATCGTCTTCACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-561s21c1
Sequence:CCGGATGGAGCCAGGAAGACAAATTCTCGAGAATTTGTCTTCCTGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-1002s21c1
Sequence:CCGGAGACCCTTTCAGACATGCATGCTCGAGCATGCATGTCTGAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-1608s21c1
Sequence:CCGGGCCCTCTGTGCCTCTTATTAACTCGAGTTAATAAGAGGCACAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-584s21c1
Sequence:CCGGCTCTTGAGAGTCAACTGATCTCTCGAGAGATCAGTTGACTCTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136233
SUPT20HL2 MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 20 homolog (S. cerevisiae)-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-527s21c1
Sequence:CCGGCTGAGGTGAAGACGATGACAACTCGAGTTGTCATCGTCTTCACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-561s21c1
Sequence:CCGGATGGAGCCAGGAAGACAAATTCTCGAGAATTTGTCTTCCTGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-1002s21c1
Sequence:CCGGAGACCCTTTCAGACATGCATGCTCGAGCATGCATGTCTGAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-1608s21c1
Sequence:CCGGGCCCTCTGTGCCTCTTATTAACTCGAGTTAATAAGAGGCACAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136233.1-584s21c1
Sequence:CCGGCTCTTGAGAGTCAACTGATCTCTCGAGAGATCAGTTGACTCTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks