EMAIL THIS PAGE TO A FRIEND

SUPT3H

suppressor of Ty 3 homolog (S. cerevisiae)

Synonyms: SPT3 SPT3L
UniProtKB ID: O75486, A6NKG9, B2R9Q5, O76066, Q5TAV9, Q86VN7
Gene ID:
Rat(685697) suppressor of Ty 3 homolog (S. cerevisiae)
cow(618133) suppressor of Ty 3 homolog (S. cerevisiae)
Goat(100861008) suppressor of Ty 3 homolog (S. cerevisiae)
sheep(101119082) suppressor of Ty 3 homolog (S. cerevisiae)
naked mole-rat(101723447) suppressor of Ty 3 homolog (S. cerevisiae)
Zebrafish(436898) suppressor of Ty 3 homolog (S. cerevisiae)
dog(474922) suppressor of Ty 3 homolog (S. cerevisiae)
domestic cat(101098540) suppressor of Ty 3 homolog (S. cerevisiae)
chicken(422053) suppressor of Ty 3 homolog (S. cerevisiae)
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003599 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156081 MISSION® esiRNA esiRNA human SUPT3H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003599 Rosetta Predictions human pricing
NM_181356 Rosetta Predictions human pricing
XM_001064890 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023330 predicted 744
2 SASI_Hs01_00023331 predicted 758
3 SASI_Hs01_00023332 predicted 441
4 SASI_Hs01_00023333 predicted 623
5 SASI_Hs01_00023334 predicted 601
6 SASI_Hs01_00023335 predicted 427
7 SASI_Hs02_00335931 predicted 839
8 SASI_Hs01_00023336 predicted 719
9 SASI_Hs01_00023337 predicted 388
10 SASI_Hs01_00023338 predicted 535
11 SASI_Hs01_00023339 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180832 predicted 1018
2 SASI_Hs01_00180833 predicted 1038
3 SASI_Hs01_00180834 predicted 724
4 SASI_Hs01_00180835 predicted 900
5 SASI_Hs01_00180836 predicted 877
6 SASI_Hs01_00180837 predicted 708
7 SASI_Hs02_00370024 predicted 1118
8 SASI_Hs01_00180838 predicted 991
9 SASI_Hs01_00180839 predicted 671
10 SASI_Hs01_00180840 predicted 812
11 SASI_Hs01_00180841 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312112 predicted 267
2 SASI_Rn02_00312113 predicted 235
3 SASI_Rn02_00312114 predicted 326
4 SASI_Rn02_00312115 predicted 516
5 SASI_Rn02_00312116 predicted 460
6 SASI_Rn02_00312117 predicted 420
7 SASI_Rn02_00312118 predicted 488
8 SASI_Rn02_00312119 predicted 636
9 SASI_Rn02_00312120 predicted 471
10 SASI_Rn02_00312121 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003599
VALIDATED
SUPT3H MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 3 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-708s1c1
Sequence:CCGGCCCAATGTTGTCGCAATGGAACTCGAGTTCCATTGCGACAACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-380s1c1
Sequence:CCGGCCGAGACTACAAATCAAAGATCTCGAGATCTTTGATTTGTAGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-952s1c1
Sequence:CCGGGCCACAGGATTGGCCCACTTTCTCGAGAAAGTGGGCCAATCCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-228s1c1
Sequence:CCGGGATGTGGTACACACTCAGTTACTCGAGTAACTGAGTGTGTACCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003599.1-594s1c1
Sequence:CCGGCGAATTATGGATTCAGCTCAACTCGAGTTGAGCTGAATCCATAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-125s21c1
Sequence:CCGGGAGTACAGGGAAGTCTATAAGCTCGAGCTTATAGACTTCCCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-162s21c1
Sequence:CCGGCAGAGTATGATGTATTCTTTACTCGAGTAAAGAATACATCATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-191s21c1
Sequence:CCGGTAGAAGGCCTCTTCATGAAACCTCGAGGTTTCATGAAGAGGCCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-734s21c1
Sequence:CCGGAGCATATTTAGCGTATGAAACCTCGAGGTTTCATACGCTAAATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-625s21c1
Sequence:CCGGTCTGTGAAAGTCGACAATTAACTCGAGTTAATTGTCGACTTTCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-528s21c1
Sequence:CCGGATGTTTGAAGATGACGAAATTCTCGAGAATTTCGTCATCTTCAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003599
VALIDATED
SUPT3H MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 3 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-708s1c1
Sequence:CCGGCCCAATGTTGTCGCAATGGAACTCGAGTTCCATTGCGACAACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-380s1c1
Sequence:CCGGCCGAGACTACAAATCAAAGATCTCGAGATCTTTGATTTGTAGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-952s1c1
Sequence:CCGGGCCACAGGATTGGCCCACTTTCTCGAGAAAGTGGGCCAATCCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-228s1c1
Sequence:CCGGGATGTGGTACACACTCAGTTACTCGAGTAACTGAGTGTGTACCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003599.1-594s1c1
Sequence:CCGGCGAATTATGGATTCAGCTCAACTCGAGTTGAGCTGAATCCATAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-125s21c1
Sequence:CCGGGAGTACAGGGAAGTCTATAAGCTCGAGCTTATAGACTTCCCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-162s21c1
Sequence:CCGGCAGAGTATGATGTATTCTTTACTCGAGTAAAGAATACATCATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-191s21c1
Sequence:CCGGTAGAAGGCCTCTTCATGAAACCTCGAGGTTTCATGAAGAGGCCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-734s21c1
Sequence:CCGGAGCATATTTAGCGTATGAAACCTCGAGGTTTCATACGCTAAATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-625s21c1
Sequence:CCGGTCTGTGAAAGTCGACAATTAACTCGAGTTAATTGTCGACTTTCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-528s21c1
Sequence:CCGGATGTTTGAAGATGACGAAATTCTCGAGAATTTCGTCATCTTCAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003599
VALIDATED
SUPT3H MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 3 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-708s1c1
Sequence:CCGGCCCAATGTTGTCGCAATGGAACTCGAGTTCCATTGCGACAACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-380s1c1
Sequence:CCGGCCGAGACTACAAATCAAAGATCTCGAGATCTTTGATTTGTAGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-952s1c1
Sequence:CCGGGCCACAGGATTGGCCCACTTTCTCGAGAAAGTGGGCCAATCCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003599.1-228s1c1
Sequence:CCGGGATGTGGTACACACTCAGTTACTCGAGTAACTGAGTGTGTACCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003599.1-594s1c1
Sequence:CCGGCGAATTATGGATTCAGCTCAACTCGAGTTGAGCTGAATCCATAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-125s21c1
Sequence:CCGGGAGTACAGGGAAGTCTATAAGCTCGAGCTTATAGACTTCCCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-162s21c1
Sequence:CCGGCAGAGTATGATGTATTCTTTACTCGAGTAAAGAATACATCATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-191s21c1
Sequence:CCGGTAGAAGGCCTCTTCATGAAACCTCGAGGTTTCATGAAGAGGCCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-734s21c1
Sequence:CCGGAGCATATTTAGCGTATGAAACCTCGAGGTTTCATACGCTAAATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-625s21c1
Sequence:CCGGTCTGTGAAAGTCGACAATTAACTCGAGTTAATTGTCGACTTTCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003599.2-528s21c1
Sequence:CCGGATGTTTGAAGATGACGAAATTCTCGAGAATTTCGTCATCTTCAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks