EMAIL THIS PAGE TO A FRIEND

SUPT4H1

suppressor of Ty 4 homolog 1 (S. cerevisiae)

Synonyms: SPT4 SPT4H SUPT4H
UniProtKB ID: P63272, B2R4X8, D3DTZ4, Q16550, Q62387, Q6ZP89
Gene ID:
Human(6827) Summary: This gene encodes the small subunit of DRB (5,6-dichloro-1-beta-d-ribofuranosylbenzimidazole) sensitivity-inducing factor (DSIF) complex, which regulates mRNA processing and transcription elongation by RNA polymerase II. The encoded protein is localized to the nucleus and interacts with the large subunit (SUPT5H) to form the DSIF complex. Related pseudogenes have been identified on chromosomes 2 and 12. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]
Rat(287608) suppressor of Ty 4 homolog 1 (S. cerevisiae)
cow(616425) suppressor of Ty 4 homolog 1 (S. cerevisiae)
sheep(101123569) suppressor of Ty 4 homolog 1 (S. cerevisiae)
Zebrafish(436782) suppressor of Ty 4 homolog 1 (S. cerevisiae)
domestic cat(101083123) suppressor of Ty 4 homolog 1 (S. cerevisiae)
dog(609757) suppressor of Ty 4 homolog 1 (S. cerevisiae)
chicken(417470) suppressor of Ty 4 homolog 1 (S. cerevisiae)
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003168 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220731 MISSION® esiRNA esiRNA targeting human SUPT4H1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003168 Rosetta Predictions human pricing
NM_001105828 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335178 predicted 463
2 SASI_Hs01_00066647 predicted 793
3 SASI_Hs01_00066648 predicted 598
4 SASI_Hs01_00066649 predicted 837
5 SASI_Hs01_00066651 predicted 797
6 SASI_Hs01_00066652 predicted 706
7 SASI_Hs02_00335179 predicted 345
8 SASI_Hs01_00066653 predicted 632
9 SASI_Hs01_00066654 predicted 517
10 SASI_Hs01_00066655 predicted 701
11 SASI_Hs01_00066650 predicted 206
12 SASI_Hs01_00066656 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212926 predicted 359
2 SASI_Rn02_00212927 predicted 498
3 SASI_Rn02_00212928 predicted 473
4 SASI_Rn02_00212929 predicted 378
5 SASI_Rn02_00212930 predicted 484
6 SASI_Rn02_00212931 predicted 497
7 SASI_Rn02_00212932 predicted 459
8 SASI_Rn02_00212933 predicted 498
9 SASI_Rn02_00212934 predicted 287
10 SASI_Rn02_00212935 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003168
VALIDATED
SUPT4H1 MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 4 homolog 1 (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003168.1-778s1c1
Sequence:CCGGCCATTCTCTTAGGCACAGTAACTCGAGTTACTGTGCCTAAGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003168.1-207s1c1
Sequence:CCGGAGATGGTATATGACTGCACTACTCGAGTAGTGCAGTCATATACCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003168.1-289s1c1
Sequence:CCGGGCAGCGAGTCAGTAACTTTAACTCGAGTTAAAGTTACTGACTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003168.1-238s1c1
Sequence:CCGGTGATGGAATCATTGCGATGATCTCGAGATCATCGCAATGATTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003168.1-289s21c1
Sequence:CCGGGCAGCGAGTCAGTAACTTTAACTCGAGTTAAAGTTACTGACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003168.1-238s21c1
Sequence:CCGGTGATGGAATCATTGCGATGATCTCGAGATCATCGCAATGATTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003168.1-778s21c1
Sequence:CCGGCCATTCTCTTAGGCACAGTAACTCGAGTTACTGTGCCTAAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003168.1-131s21c1
Sequence:CCGGGTCAAGACTATAGACCAGTTTCTCGAGAAACTGGTCTATAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003168
VALIDATED
SUPT4H1 MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 4 homolog 1 (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003168.1-778s1c1
Sequence:CCGGCCATTCTCTTAGGCACAGTAACTCGAGTTACTGTGCCTAAGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003168.1-207s1c1
Sequence:CCGGAGATGGTATATGACTGCACTACTCGAGTAGTGCAGTCATATACCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003168.1-289s1c1
Sequence:CCGGGCAGCGAGTCAGTAACTTTAACTCGAGTTAAAGTTACTGACTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003168.1-238s1c1
Sequence:CCGGTGATGGAATCATTGCGATGATCTCGAGATCATCGCAATGATTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003168.1-289s21c1
Sequence:CCGGGCAGCGAGTCAGTAACTTTAACTCGAGTTAAAGTTACTGACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003168.1-238s21c1
Sequence:CCGGTGATGGAATCATTGCGATGATCTCGAGATCATCGCAATGATTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003168.1-778s21c1
Sequence:CCGGCCATTCTCTTAGGCACAGTAACTCGAGTTACTGTGCCTAAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003168.1-131s21c1
Sequence:CCGGGTCAAGACTATAGACCAGTTTCTCGAGAAACTGGTCTATAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003168
VALIDATED
SUPT4H1 MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 4 homolog 1 (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003168.1-778s1c1
Sequence:CCGGCCATTCTCTTAGGCACAGTAACTCGAGTTACTGTGCCTAAGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003168.1-207s1c1
Sequence:CCGGAGATGGTATATGACTGCACTACTCGAGTAGTGCAGTCATATACCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003168.1-289s1c1
Sequence:CCGGGCAGCGAGTCAGTAACTTTAACTCGAGTTAAAGTTACTGACTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003168.1-238s1c1
Sequence:CCGGTGATGGAATCATTGCGATGATCTCGAGATCATCGCAATGATTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003168.1-289s21c1
Sequence:CCGGGCAGCGAGTCAGTAACTTTAACTCGAGTTAAAGTTACTGACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003168.1-238s21c1
Sequence:CCGGTGATGGAATCATTGCGATGATCTCGAGATCATCGCAATGATTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003168.1-778s21c1
Sequence:CCGGCCATTCTCTTAGGCACAGTAACTCGAGTTACTGTGCCTAAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003168.1-131s21c1
Sequence:CCGGGTCAAGACTATAGACCAGTTTCTCGAGAAACTGGTCTATAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks