EMAIL THIS PAGE TO A FRIEND

SUPT5H

suppressor of Ty 5 homolog (S. cerevisiae)

Synonyms: SPT5 SPT5H Tat-CT1
UniProtKB ID: O00267, O43279, Q59G52, Q99639
Gene ID:
Rat(308472) suppressor of Ty 5 homolog (S. cerevisiae)
cow(519808) suppressor of Ty 5 homolog (S. cerevisiae)
sheep(101115896) suppressor of Ty 5 homolog (S. cerevisiae)
domestic guinea pig(100713914) suppressor of Ty 5 homolog (S. cerevisiae)
naked mole-rat(101726331) suppressor of Ty 5 homolog (S. cerevisiae)
Domestic Rabbit(100356793) suppressor of Ty 5 homolog (S. cerevisiae)
Zebrafish(64275) suppressor of Ty 5 homolog (S. cerevisiae)
Horse(100064516) suppressor of Ty 5 homolog (S. cerevisiae)
domestic cat(101095937) suppressor of Ty 5 homolog (S. cerevisiae)
dog(476462) suppressor of Ty 5 homolog (S. cerevisiae)
chicken(426493) suppressor of Ty 5 homolog (S. cerevisiae)
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701635 Anti-supt5h antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
AV33386 Anti-SUPT5H antibody produced in rabbit affinity isolated antibody bovine, rat, guinea pig, rabbit, zebrafish, mouse, human, canine, horse,
immunohistochemistry, western blot pricing
SAB2102337 Anti-SUPT5H antibody produced in rabbit affinity isolated antibody canine, human, horse, bovine, guinea pig, rabbit, mouse, zebrafish
western blot pricing
HPA029273 Anti-SUPT5H antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
WH0006829M1 Monoclonal Anti-SUPT5H antibody produced in mouse clone 3F1, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409713 Monoclonal Anti-SUPT5H antibody produced in mouse clone 5C8, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB1409714 Monoclonal Anti-SUPT5H antibody produced in mouse clone 5C8, ascites fluid, solution human, rat
ELISA, western blot pricing
SAB1404429 Monoclonal Anti-SUPT5H, (C-terminal) antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003169 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111020 Rosetta Predictions human pricing
NM_003169 Rosetta Predictions human pricing
NM_001107497 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325086 predicted 1787
2 SASI_Hs02_00325087 predicted 720
3 SASI_Hs02_00325088 predicted 999
4 SASI_Hs02_00325089 predicted 2643
5 SASI_Hs02_00325090 predicted 676
6 SASI_Hs02_00325091 predicted 2300
7 SASI_Hs02_00325092 predicted 1440
8 SASI_Hs02_00325093 predicted 612
9 SASI_Hs02_00325094 predicted 677
10 SASI_Hs02_00325095 predicted 2796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198559 predicted 1885
2 SASI_Hs01_00198560 predicted 813
3 SASI_Hs01_00198561 predicted 1088
4 SASI_Hs01_00198562 predicted 2737
5 SASI_Hs01_00198563 predicted 764
6 SASI_Hs02_00335180 predicted 2391
7 SASI_Hs01_00198565 predicted 1539
8 SASI_Hs01_00198566 predicted 707
9 SASI_Hs01_00198567 predicted 766
10 SASI_Hs01_00198568 predicted 2884
11 SASI_Hs01_00198564 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229415 predicted 222
2 SASI_Rn02_00229416 predicted 236
3 SASI_Rn02_00229417 predicted 240
4 SASI_Rn02_00229418 predicted 246
5 SASI_Rn02_00229419 predicted 238
6 SASI_Rn02_00229420 predicted 245
7 SASI_Rn02_00229421 predicted 223
8 SASI_Rn02_00229422 predicted 242
9 SASI_Rn02_00229423 predicted 230
10 SASI_Rn02_00229424 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003169
VALIDATED
SUPT5H MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 5 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003169.2-1989s1c1
Sequence:CCGGCCATGTGAAAGACATCGTTAACTCGAGTTAACGATGTCTTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-736s1c1
Sequence:CCGGCCCAATCTGTGGACTGTCAAACTCGAGTTTGACAGTCCACAGATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-445s1c1
Sequence:CCGGGCTGATGTTGACGATGAGTATCTCGAGATACTCATCGTCAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003169.2-3373s1c1
Sequence:CCGGCTGAGCATTGATGGTGAGGATCTCGAGATCCTCACCATCAATGCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-620s1c1
Sequence:CCGGGCGAGTATTACATGAAGAAATCTCGAGATTTCTTCATGTAATACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-656s21c1
Sequence:CCGGGCGAGTATTACATGAAGAAATCTCGAGATTTCTTCATGTAATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-481s21c1
Sequence:CCGGGCTGATGTTGACGATGAGTATCTCGAGATACTCATCGTCAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-2025s21c1
Sequence:CCGGCCATGTGAAAGACATCGTTAACTCGAGTTAACGATGTCTTTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-3409s21c1
Sequence:CCGGCTGAGCATTGATGGTGAGGATCTCGAGATCCTCACCATCAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-772s21c1
Sequence:CCGGCCCAATCTGTGGACTGTCAAACTCGAGTTTGACAGTCCACAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003169
VALIDATED
SUPT5H MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 5 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003169.2-1989s1c1
Sequence:CCGGCCATGTGAAAGACATCGTTAACTCGAGTTAACGATGTCTTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-736s1c1
Sequence:CCGGCCCAATCTGTGGACTGTCAAACTCGAGTTTGACAGTCCACAGATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-445s1c1
Sequence:CCGGGCTGATGTTGACGATGAGTATCTCGAGATACTCATCGTCAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003169.2-3373s1c1
Sequence:CCGGCTGAGCATTGATGGTGAGGATCTCGAGATCCTCACCATCAATGCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-620s1c1
Sequence:CCGGGCGAGTATTACATGAAGAAATCTCGAGATTTCTTCATGTAATACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-656s21c1
Sequence:CCGGGCGAGTATTACATGAAGAAATCTCGAGATTTCTTCATGTAATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-481s21c1
Sequence:CCGGGCTGATGTTGACGATGAGTATCTCGAGATACTCATCGTCAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-2025s21c1
Sequence:CCGGCCATGTGAAAGACATCGTTAACTCGAGTTAACGATGTCTTTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-3409s21c1
Sequence:CCGGCTGAGCATTGATGGTGAGGATCTCGAGATCCTCACCATCAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-772s21c1
Sequence:CCGGCCCAATCTGTGGACTGTCAAACTCGAGTTTGACAGTCCACAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003169
VALIDATED
SUPT5H MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 5 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003169.2-1989s1c1
Sequence:CCGGCCATGTGAAAGACATCGTTAACTCGAGTTAACGATGTCTTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-736s1c1
Sequence:CCGGCCCAATCTGTGGACTGTCAAACTCGAGTTTGACAGTCCACAGATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-445s1c1
Sequence:CCGGGCTGATGTTGACGATGAGTATCTCGAGATACTCATCGTCAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003169.2-3373s1c1
Sequence:CCGGCTGAGCATTGATGGTGAGGATCTCGAGATCCTCACCATCAATGCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003169.2-620s1c1
Sequence:CCGGGCGAGTATTACATGAAGAAATCTCGAGATTTCTTCATGTAATACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-656s21c1
Sequence:CCGGGCGAGTATTACATGAAGAAATCTCGAGATTTCTTCATGTAATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-481s21c1
Sequence:CCGGGCTGATGTTGACGATGAGTATCTCGAGATACTCATCGTCAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-2025s21c1
Sequence:CCGGCCATGTGAAAGACATCGTTAACTCGAGTTAACGATGTCTTTCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-3409s21c1
Sequence:CCGGCTGAGCATTGATGGTGAGGATCTCGAGATCCTCACCATCAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003169.3-772s21c1
Sequence:CCGGCCCAATCTGTGGACTGTCAAACTCGAGTTTGACAGTCCACAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks