EMAIL THIS PAGE TO A FRIEND

SUPT6H

suppressor of Ty 6 homolog (S. cerevisiae)

Synonyms: SPT6 SPT6H emb-5
Gene ID:
Rat(303281) suppressor of Ty 6 homolog (S. cerevisiae)
cow(538671) suppressor of Ty 6 homolog (S. cerevisiae)
sheep(101106442) suppressor of Ty 6 homolog (S. cerevisiae)
naked mole-rat(101712658) suppressor of Ty 6 homolog (S. cerevisiae)
domestic guinea pig(100724472) suppressor of Ty 6 homolog (S. cerevisiae)
Zebrafish(337866) suppressor of Ty 6 homolog
chicken(425418) suppressor of Ty 6 homolog (S. cerevisiae)
dog(480627) suppressor of Ty 6 homolog (S. cerevisiae)
Horse(100059341) suppressor of Ty 6 homolog (S. cerevisiae)
domestic cat(101097850) suppressor of Ty 6 homolog (S. cerevisiae)
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38260 Anti-SUPT6H antibody produced in rabbit IgG fraction of antiserum zebrafish, guinea pig, rabbit, human, horse, bovine, canine, mouse
western blot pricing
SAB2102338 Anti-SUPT6H antibody produced in rabbit affinity isolated antibody bovine, rat, horse, human, rabbit, canine, mouse
western blot pricing
HPA036382 Anti-SUPT6H antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377464 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_003170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003170 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156821 MISSION® esiRNA esiRNA human SUPT6H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003170 Rosetta Predictions human pricing
XM_001080796 Rosetta Predictions rat pricing
XM_239258 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335181 predicted 610
2 SASI_Hs01_00099661 predicted 1039
3 SASI_Hs01_00099662 predicted 4608
4 SASI_Hs01_00099663 predicted 2007
5 SASI_Hs01_00099664 predicted 3272
6 SASI_Hs01_00099665 predicted 1975
7 SASI_Hs02_00335182 predicted 1505
8 SASI_Hs01_00099666 predicted 3696
9 SASI_Hs02_00335183 predicted 2095
10 SASI_Hs02_00335184 predicted 4709
11 SASI_Hs01_00099667 predicted 1715
12 SASI_Hs01_00099668 predicted 1458
13 SASI_Hs01_00099669 predicted 526
14 SASI_Hs01_00099670 predicted 2973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369412 predicted 3353
2 SASI_Rn02_00369413 predicted 2787
3 SASI_Rn02_00369414 predicted 3607
4 SASI_Rn02_00369415 predicted 4980
5 SASI_Rn02_00369416 predicted 5483
6 SASI_Rn02_00369417 predicted 1168
7 SASI_Rn02_00369418 predicted 2855
8 SASI_Rn02_00369419 predicted 1889
9 SASI_Rn02_00369420 predicted 3360
10 SASI_Rn02_00369421 predicted 4347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_239258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391494 predicted 3347
2 SASI_Rn02_00391495 predicted 2784
3 SASI_Rn02_00391496 predicted 3612
4 SASI_Rn02_00391497 predicted 4985
5 SASI_Rn02_00391498 predicted 5481
6 SASI_Rn02_00391499 predicted 1175
7 SASI_Rn02_00391500 predicted 2855
8 SASI_Rn02_00391501 predicted 1893
9 SASI_Rn02_00391502 predicted 3362
10 SASI_Rn02_00391503 predicted 4343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377464
VALIDATED
SUPT6H MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 6 homolog (S. cerevisiae)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000019729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-3212s1c1
Sequence:CCGGCCCTTGAAGAAATCTTGGAAACTCGAGTTTCCAAGATTTCTTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-4311s1c1
Sequence:CCGGGCCCACCTTCATCCCTTATTTCTCGAGAAATAAGGGATGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-2817s1c1
Sequence:CCGGCGCCTTGTACTGTGAATTTATCTCGAGATAAATTCACAGTACAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-4453s1c1
Sequence:CCGGCCAACCGTGAATGGACTGTTTCTCGAGAAACAGTCCATTCACGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377464
VALIDATED
SUPT6H MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 6 homolog (S. cerevisiae)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000019729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-3212s1c1
Sequence:CCGGCCCTTGAAGAAATCTTGGAAACTCGAGTTTCCAAGATTTCTTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-4311s1c1
Sequence:CCGGGCCCACCTTCATCCCTTATTTCTCGAGAAATAAGGGATGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-2817s1c1
Sequence:CCGGCGCCTTGTACTGTGAATTTATCTCGAGATAAATTCACAGTACAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-4453s1c1
Sequence:CCGGCCAACCGTGAATGGACTGTTTCTCGAGAAACAGTCCATTCACGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377464
VALIDATED
SUPT6H MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 6 homolog (S. cerevisiae)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000019729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-3212s1c1
Sequence:CCGGCCCTTGAAGAAATCTTGGAAACTCGAGTTTCCAAGATTTCTTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-4311s1c1
Sequence:CCGGGCCCACCTTCATCCCTTATTTCTCGAGAAATAAGGGATGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-2817s1c1
Sequence:CCGGCGCCTTGTACTGTGAATTTATCTCGAGATAAATTCACAGTACAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:XM_377464.1-4453s1c1
Sequence:CCGGCCAACCGTGAATGGACTGTTTCTCGAGAAACAGTCCATTCACGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003170
VALIDATED
SUPT6H MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 6 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-4452s21c1
Sequence:CCGGGCCCACCTTCATCCCTTATTTCTCGAGAAATAAGGGATGAAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003170.3-2958s21c1
Sequence:CCGGCGCCTTGTACTGTGAATTTATCTCGAGATAAATTCACAGTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003170.3-526s21c1
Sequence:CCGGGCGGAAGAAATCTTCCAGGATCTCGAGATCCTGGAAGATTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-4594s21c1
Sequence:CCGGCCAACCGTGAATGGACTGTTTCTCGAGAAACAGTCCATTCACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-3353s21c1
Sequence:CCGGCCCTTGAAGAAATCTTGGAAACTCGAGTTTCCAAGATTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003170
VALIDATED
SUPT6H MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 6 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-4452s21c1
Sequence:CCGGGCCCACCTTCATCCCTTATTTCTCGAGAAATAAGGGATGAAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003170.3-2958s21c1
Sequence:CCGGCGCCTTGTACTGTGAATTTATCTCGAGATAAATTCACAGTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003170.3-526s21c1
Sequence:CCGGGCGGAAGAAATCTTCCAGGATCTCGAGATCCTGGAAGATTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-4594s21c1
Sequence:CCGGCCAACCGTGAATGGACTGTTTCTCGAGAAACAGTCCATTCACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-3353s21c1
Sequence:CCGGCCCTTGAAGAAATCTTGGAAACTCGAGTTTCCAAGATTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003170
VALIDATED
SUPT6H MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 6 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-4452s21c1
Sequence:CCGGGCCCACCTTCATCCCTTATTTCTCGAGAAATAAGGGATGAAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003170.3-2958s21c1
Sequence:CCGGCGCCTTGTACTGTGAATTTATCTCGAGATAAATTCACAGTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003170.3-526s21c1
Sequence:CCGGGCGGAAGAAATCTTCCAGGATCTCGAGATCCTGGAAGATTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-4594s21c1
Sequence:CCGGCCAACCGTGAATGGACTGTTTCTCGAGAAACAGTCCATTCACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003170.3-3353s21c1
Sequence:CCGGCCCTTGAAGAAATCTTGGAAACTCGAGTTTCCAAGATTTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks