EMAIL THIS PAGE TO A FRIEND

SUPT7L

suppressor of Ty 7 (S. cerevisiae)-like

Synonyms: SPT7L STAF65 STAF65(gamma) STAF65G SUPT7H
UniProtKB ID: O94864, Q6IB21, Q9H2T6
Gene ID:
Human(9913) Summary: SUPT7L is a protein subunit of the human STAGA complex (SPT3; (MIM 602947)/TAF9 (MIM 600822)/GCN5 (MIM 602301) acetyltransferase complex), which is a chromatin-modifying multiprotein complex (Martinez et al., 2001 [PubMed 11564863]
Mouse(72195) suppressor of Ty 7-like
Rat(313905) suppressor of Ty 7 (S. cerevisiae)-like
Zebrafish(503605) suppressor of Ty 7 (S. cerevisiae)-like
chicken(421421) suppressor of Ty 7 (S. cerevisiae)-like
domestic cat(101095005) suppressor of Ty 7 (S. cerevisiae)-like
Horse(100055010) suppressor of Ty 7 (S. cerevisiae)-like
domestic guinea pig(100720984) suppressor of Ty 7 (S. cerevisiae)-like
naked mole-rat(101722013) suppressor of Ty 7 (S. cerevisiae)-like
Domestic Rabbit(100348215) suppressor of Ty 7 (S. cerevisiae)-like
cow(539152) suppressor of Ty 7 (S. cerevisiae)-like
sheep(101120226) suppressor of Ty 7 (S. cerevisiae)-like
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069751 MISSION® esiRNA esiRNA human SUPT7L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014860 Rosetta Predictions human pricing
NM_001108010 Rosetta Predictions rat pricing
NM_028150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165546 predicted 1613
2 SASI_Hs01_00165547 predicted 1063
3 SASI_Hs01_00165548 predicted 1343
4 SASI_Hs01_00165549 predicted 1667
5 SASI_Hs01_00165550 predicted 1328
6 SASI_Hs01_00165551 predicted 881
7 SASI_Hs01_00165552 predicted 896
8 SASI_Hs01_00165553 predicted 855
9 SASI_Hs01_00165554 predicted 1144
10 SASI_Hs01_00165555 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234475 predicted 591
2 SASI_Rn02_00234476 predicted 1588
3 SASI_Rn02_00234477 predicted 1529
4 SASI_Rn02_00234478 predicted 974
5 SASI_Rn02_00234479 predicted 1549
6 SASI_Rn02_00234480 predicted 1539
7 SASI_Rn02_00234481 predicted 1357
8 SASI_Rn02_00234482 predicted 1573
9 SASI_Rn02_00234483 predicted 482
10 SASI_Rn02_00234484 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056056 predicted 1526
2 SASI_Mm02_00333427 predicted 1101
3 SASI_Mm01_00056057 predicted 973
4 SASI_Mm01_00056059 predicted 1535
5 SASI_Mm01_00056060 predicted 982
6 SASI_Mm01_00056062 predicted 415
7 SASI_Mm01_00056063 predicted 979
8 SASI_Mm01_00056064 predicted 800
9 SASI_Mm02_00333428 predicted 285
10 SASI_Mm01_00056065 predicted 767
11 SASI_Mm01_00056058 predicted 593
12 SASI_Mm01_00056061 predicted 1558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014860
VALIDATED
SUPT7L MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 7 (S. cerevisiae)-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-393s21c1
Sequence:CCGGCCAACAGAAGTTCCTTCGATTCTCGAGAATCGAAGGAACTTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-998s21c1
Sequence:CCGGGTATTCCATGAAGTGGGTATTCTCGAGAATACCCACTTCATGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-518s21c1
Sequence:CCGGCCATGTAGTCTCACCATCCATCTCGAGATGGATGGTGAGACTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014860.1-848s21c1
Sequence:CCGGGCGGGCTTTGACTGTGCTAATCTCGAGATTAGCACAGTCAAAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014860.1-2051s21c1
Sequence:CCGGCATTGGGAACCCATTACTAATCTCGAGATTAGTAATGGGTTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014860
VALIDATED
SUPT7L MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 7 (S. cerevisiae)-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-393s21c1
Sequence:CCGGCCAACAGAAGTTCCTTCGATTCTCGAGAATCGAAGGAACTTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-998s21c1
Sequence:CCGGGTATTCCATGAAGTGGGTATTCTCGAGAATACCCACTTCATGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-518s21c1
Sequence:CCGGCCATGTAGTCTCACCATCCATCTCGAGATGGATGGTGAGACTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014860.1-848s21c1
Sequence:CCGGGCGGGCTTTGACTGTGCTAATCTCGAGATTAGCACAGTCAAAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014860.1-2051s21c1
Sequence:CCGGCATTGGGAACCCATTACTAATCTCGAGATTAGTAATGGGTTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014860
VALIDATED
SUPT7L MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 7 (S. cerevisiae)-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-393s21c1
Sequence:CCGGCCAACAGAAGTTCCTTCGATTCTCGAGAATCGAAGGAACTTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-998s21c1
Sequence:CCGGGTATTCCATGAAGTGGGTATTCTCGAGAATACCCACTTCATGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014860.1-518s21c1
Sequence:CCGGCCATGTAGTCTCACCATCCATCTCGAGATGGATGGTGAGACTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014860.1-848s21c1
Sequence:CCGGGCGGGCTTTGACTGTGCTAATCTCGAGATTAGCACAGTCAAAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014860.1-2051s21c1
Sequence:CCGGCATTGGGAACCCATTACTAATCTCGAGATTAGTAATGGGTTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376044
VALIDATED
SUPT7L MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 7 (S. cerevisiae)-like
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000019774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376044.1-451s1c1
Sequence:CCGGCCAACAGAAGTTCCTTCGATTCTCGAGAATCGAAGGAACTTCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_376044.1-576s1c1
Sequence:CCGGCCATGTAGTCTCACCATCCATCTCGAGATGGATGGTGAGACTACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_376044.1-1056s1c1
Sequence:CCGGGTATTCCATGAAGTGGGTATTCTCGAGAATACCCACTTCATGGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376044.1-906s1c1
Sequence:CCGGGCGGGCTTTGACTGTGCTAATCTCGAGATTAGCACAGTCAAAGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376044
VALIDATED
SUPT7L MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 7 (S. cerevisiae)-like
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000019774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376044.1-451s1c1
Sequence:CCGGCCAACAGAAGTTCCTTCGATTCTCGAGAATCGAAGGAACTTCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_376044.1-576s1c1
Sequence:CCGGCCATGTAGTCTCACCATCCATCTCGAGATGGATGGTGAGACTACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_376044.1-1056s1c1
Sequence:CCGGGTATTCCATGAAGTGGGTATTCTCGAGAATACCCACTTCATGGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376044.1-906s1c1
Sequence:CCGGGCGGGCTTTGACTGTGCTAATCTCGAGATTAGCACAGTCAAAGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376044
VALIDATED
SUPT7L MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 7 (S. cerevisiae)-like
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000019774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376044.1-451s1c1
Sequence:CCGGCCAACAGAAGTTCCTTCGATTCTCGAGAATCGAAGGAACTTCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_376044.1-576s1c1
Sequence:CCGGCCATGTAGTCTCACCATCCATCTCGAGATGGATGGTGAGACTACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:XM_376044.1-1056s1c1
Sequence:CCGGGTATTCCATGAAGTGGGTATTCTCGAGAATACCCACTTCATGGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376044.1-906s1c1
Sequence:CCGGGCGGGCTTTGACTGTGCTAATCTCGAGATTAGCACAGTCAAAGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355594
VALIDATED
SUPT7L MISSION shRNA Bacterial Glycerol Stock
suppressor of Ty 7 (S. cerevisiae)-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000086633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-718s1c1
Sequence:CCGGGCTTTGAGTGTGCTAATGAAACTCGAGTTTCATTAGCACACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-551s1c1
Sequence:CCGGCCTCCAGCCTTTAGACTGTAACTCGAGTTACAGTCTAAAGGCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-1095s1c1
Sequence:CCGGGCTTCTGGAGATCAGTCCTTACTCGAGTAAGGACTGATCTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-1433s1c1
Sequence:CCGGGAAGAGGATGAGGAAGATTTACTCGAGTAAATCTTCCTCATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355594
VALIDATED
SUPT7L MISSION shRNA shRNA Plasmid DNA
suppressor of Ty 7 (S. cerevisiae)-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000086633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-718s1c1
Sequence:CCGGGCTTTGAGTGTGCTAATGAAACTCGAGTTTCATTAGCACACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-551s1c1
Sequence:CCGGCCTCCAGCCTTTAGACTGTAACTCGAGTTACAGTCTAAAGGCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-1095s1c1
Sequence:CCGGGCTTCTGGAGATCAGTCCTTACTCGAGTAAGGACTGATCTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-1433s1c1
Sequence:CCGGGAAGAGGATGAGGAAGATTTACTCGAGTAAATCTTCCTCATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355594
VALIDATED
SUPT7L MISSION shRNA Lentiviral Transduction Particles
suppressor of Ty 7 (S. cerevisiae)-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000086633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-718s1c1
Sequence:CCGGGCTTTGAGTGTGCTAATGAAACTCGAGTTTCATTAGCACACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-551s1c1
Sequence:CCGGCCTCCAGCCTTTAGACTGTAACTCGAGTTACAGTCTAAAGGCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-1095s1c1
Sequence:CCGGGCTTCTGGAGATCAGTCCTTACTCGAGTAAGGACTGATCTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355594.1-1433s1c1
Sequence:CCGGGAAGAGGATGAGGAAGATTTACTCGAGTAAATCTTCCTCATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks