EMAIL THIS PAGE TO A FRIEND

SUPV3L1

suppressor of var1, 3-like 1 (S. cerevisiae)

Synonyms: SUV3
UniProtKB ID: Q8IYB8, A8K301, O43630
Gene ID:
Mouse(338359) suppressor of var1, 3-like 1 (S. cerevisiae)
Rat(294385) suppressor of var1, 3-like 1 (S. cerevisiae)
cow(505988) suppressor of var1, 3-like 1 (S. cerevisiae)
sheep(101107569) suppressor of var1, 3-like 1 (S. cerevisiae)
Domestic Rabbit(100345360) suppressor of var1, 3-like 1 (S. cerevisiae)
naked mole-rat(101707930) suppressor of var1, 3-like 1 (S. cerevisiae)
domestic guinea pig(100728441) suppressor of var1, 3-like 1 (S. cerevisiae)
Zebrafish(570852) suppressor of var1, 3-like 1 (S. cerevisiae)
dog(489018) suppressor of var1, 3-like 1 (S. cerevisiae)
chicken(423697) suppressor of var1, 3-like 1 (S. cerevisiae)
Horse(100072679) suppressor of var1, 3-like 1 (S. cerevisiae)
domestic cat(101094049) suppressor of var1, 3-like 1 (S. cerevisiae)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003171 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003171 Rosetta Predictions human pricing
NM_001012462 Rosetta Predictions rat pricing
NM_181423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045499 predicted 571
2 SASI_Hs01_00045500 predicted 1975
3 SASI_Hs02_00335185 predicted 2106
4 SASI_Hs02_00335186 predicted 1640
5 SASI_Hs01_00045502 predicted 411
6 SASI_Hs01_00045503 predicted 1409
7 SASI_Hs02_00335187 predicted 557
8 SASI_Hs01_00045504 predicted 390
9 SASI_Hs01_00045505 predicted 1120
10 SASI_Hs01_00045507 predicted 1672
11 SASI_Hs01_00045501 predicted 901
12 SASI_Hs01_00045506 predicted 1225
13 SASI_Hs01_00045508 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112241 predicted 2123
2 SASI_Rn01_00112243 predicted 415
3 SASI_Rn01_00112244 predicted 348
4 SASI_Rn01_00112245 predicted 510
5 SASI_Rn01_00112246 predicted 988
6 SASI_Rn01_00112247 predicted 669
7 SASI_Rn01_00112248 predicted 1136
8 SASI_Rn02_00200557 predicted 509
9 SASI_Rn02_00200558 predicted 1863
10 SASI_Rn02_00200559 predicted 2053
11 SASI_Rn01_00112240 predicted 611
12 SASI_Rn01_00112242 predicted 1120
13 SASI_Rn01_00112249 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087247 predicted 431
2 SASI_Mm02_00349781 predicted 280
3 SASI_Mm01_00087248 predicted 337
4 SASI_Mm01_00087250 predicted 684
5 SASI_Mm01_00087251 predicted 850
6 SASI_Mm01_00087252 predicted 1696
7 SASI_Mm01_00087254 predicted 1952
8 SASI_Mm01_00087255 predicted 1959
9 SASI_Mm01_00087256 predicted 657
10 SASI_Mm02_00349782 predicted 1418
11 SASI_Mm01_00087249 predicted 2016
12 SASI_Mm01_00087253 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181423
VALIDATED
SUPV3L1 MISSION shRNA Bacterial Glycerol Stock
suppressor of var1, 3-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1548s1c1
Sequence:CCGGGCCGAGCAGATTGAGATGTTTCTCGAGAAACATCTCAATCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181423.2-462s1c1
Sequence:CCGGGCAGCTCATGTGGACGATTTACTCGAGTAAATCGTCCACATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1478s1c1
Sequence:CCGGCCTGGCTTTATTGAAGGACATCTCGAGATGTCCTTCAATAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1591s1c1
Sequence:CCGGCGCTGTCCAATCTCATTGATACTCGAGTATCAATGAGATTGGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1174s21c1
Sequence:CCGGGACTGGAATCCGCGGTGATATCTCGAGATATCACCGCGGATTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1548s21c1
Sequence:CCGGGCCGAGCAGATTGAGATGTTTCTCGAGAAACATCTCAATCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1591s21c1
Sequence:CCGGCGCTGTCCAATCTCATTGATACTCGAGTATCAATGAGATTGGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181423.2-1478s21c1
Sequence:CCGGCCTGGCTTTATTGAAGGACATCTCGAGATGTCCTTCAATAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1926s21c1
Sequence:CCGGTGGCTAAGCTACCGATTTATTCTCGAGAATAAATCGGTAGCTTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181423
VALIDATED
SUPV3L1 MISSION shRNA shRNA Plasmid DNA
suppressor of var1, 3-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1548s1c1
Sequence:CCGGGCCGAGCAGATTGAGATGTTTCTCGAGAAACATCTCAATCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181423.2-462s1c1
Sequence:CCGGGCAGCTCATGTGGACGATTTACTCGAGTAAATCGTCCACATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1478s1c1
Sequence:CCGGCCTGGCTTTATTGAAGGACATCTCGAGATGTCCTTCAATAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1591s1c1
Sequence:CCGGCGCTGTCCAATCTCATTGATACTCGAGTATCAATGAGATTGGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1174s21c1
Sequence:CCGGGACTGGAATCCGCGGTGATATCTCGAGATATCACCGCGGATTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1548s21c1
Sequence:CCGGGCCGAGCAGATTGAGATGTTTCTCGAGAAACATCTCAATCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1591s21c1
Sequence:CCGGCGCTGTCCAATCTCATTGATACTCGAGTATCAATGAGATTGGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181423.2-1478s21c1
Sequence:CCGGCCTGGCTTTATTGAAGGACATCTCGAGATGTCCTTCAATAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1926s21c1
Sequence:CCGGTGGCTAAGCTACCGATTTATTCTCGAGAATAAATCGGTAGCTTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181423
VALIDATED
SUPV3L1 MISSION shRNA Lentiviral Transduction Particles
suppressor of var1, 3-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1548s1c1
Sequence:CCGGGCCGAGCAGATTGAGATGTTTCTCGAGAAACATCTCAATCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181423.2-462s1c1
Sequence:CCGGGCAGCTCATGTGGACGATTTACTCGAGTAAATCGTCCACATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1478s1c1
Sequence:CCGGCCTGGCTTTATTGAAGGACATCTCGAGATGTCCTTCAATAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181423.2-1591s1c1
Sequence:CCGGCGCTGTCCAATCTCATTGATACTCGAGTATCAATGAGATTGGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1174s21c1
Sequence:CCGGGACTGGAATCCGCGGTGATATCTCGAGATATCACCGCGGATTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1548s21c1
Sequence:CCGGGCCGAGCAGATTGAGATGTTTCTCGAGAAACATCTCAATCTGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1591s21c1
Sequence:CCGGCGCTGTCCAATCTCATTGATACTCGAGTATCAATGAGATTGGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181423.2-1478s21c1
Sequence:CCGGCCTGGCTTTATTGAAGGACATCTCGAGATGTCCTTCAATAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181423.2-1926s21c1
Sequence:CCGGTGGCTAAGCTACCGATTTATTCTCGAGAATAAATCGGTAGCTTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003171
VALIDATED
SUPV3L1 MISSION shRNA Bacterial Glycerol Stock
suppressor of var1, 3-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003171.2-1727s1c1
Sequence:CCGGGCAGAGTTGATCCAGCATATTCTCGAGAATATGCTGGATCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-830s1c1
Sequence:CCGGCGTGTGACAGTTCAGCCAAATCTCGAGATTTGGCTGAACTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003171.2-566s1c1
Sequence:CCGGCCTGTGTTGGACTGTAAGGATCTCGAGATCCTTACAGTCCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-1595s1c1
Sequence:CCGGGCTGAGCAGATTGAAATGTTTCTCGAGAAACATTTCAATCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-1882s1c1
Sequence:CCGGCCGATACATCAAATGGCCTTTCTCGAGAAAGGCCATTTGATGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003171.3-1948s21c1
Sequence:CCGGCCACGATGTCTTGGATCTTTACTCGAGTAAAGATCCAAGACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003171.3-830s21c1
Sequence:CCGGCGTGTGACAGTTCAGCCAAATCTCGAGATTTGGCTGAACTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003171.3-2146s21c1
Sequence:CCGGACGATTGTCAGGAACCTTAAACTCGAGTTTAAGGTTCCTGACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003171.3-566s21c1
Sequence:CCGGCCTGTGTTGGACTGTAAGGATCTCGAGATCCTTACAGTCCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003171
VALIDATED
SUPV3L1 MISSION shRNA shRNA Plasmid DNA
suppressor of var1, 3-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003171.2-1727s1c1
Sequence:CCGGGCAGAGTTGATCCAGCATATTCTCGAGAATATGCTGGATCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-830s1c1
Sequence:CCGGCGTGTGACAGTTCAGCCAAATCTCGAGATTTGGCTGAACTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003171.2-566s1c1
Sequence:CCGGCCTGTGTTGGACTGTAAGGATCTCGAGATCCTTACAGTCCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-1595s1c1
Sequence:CCGGGCTGAGCAGATTGAAATGTTTCTCGAGAAACATTTCAATCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-1882s1c1
Sequence:CCGGCCGATACATCAAATGGCCTTTCTCGAGAAAGGCCATTTGATGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003171.3-1948s21c1
Sequence:CCGGCCACGATGTCTTGGATCTTTACTCGAGTAAAGATCCAAGACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003171.3-830s21c1
Sequence:CCGGCGTGTGACAGTTCAGCCAAATCTCGAGATTTGGCTGAACTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003171.3-2146s21c1
Sequence:CCGGACGATTGTCAGGAACCTTAAACTCGAGTTTAAGGTTCCTGACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003171.3-566s21c1
Sequence:CCGGCCTGTGTTGGACTGTAAGGATCTCGAGATCCTTACAGTCCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003171
VALIDATED
SUPV3L1 MISSION shRNA Lentiviral Transduction Particles
suppressor of var1, 3-like 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003171.2-1727s1c1
Sequence:CCGGGCAGAGTTGATCCAGCATATTCTCGAGAATATGCTGGATCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-830s1c1
Sequence:CCGGCGTGTGACAGTTCAGCCAAATCTCGAGATTTGGCTGAACTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003171.2-566s1c1
Sequence:CCGGCCTGTGTTGGACTGTAAGGATCTCGAGATCCTTACAGTCCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-1595s1c1
Sequence:CCGGGCTGAGCAGATTGAAATGTTTCTCGAGAAACATTTCAATCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003171.2-1882s1c1
Sequence:CCGGCCGATACATCAAATGGCCTTTCTCGAGAAAGGCCATTTGATGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003171.3-1948s21c1
Sequence:CCGGCCACGATGTCTTGGATCTTTACTCGAGTAAAGATCCAAGACATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003171.3-830s21c1
Sequence:CCGGCGTGTGACAGTTCAGCCAAATCTCGAGATTTGGCTGAACTGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003171.3-2146s21c1
Sequence:CCGGACGATTGTCAGGAACCTTAAACTCGAGTTTAAGGTTCCTGACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003171.3-566s21c1
Sequence:CCGGCCTGTGTTGGACTGTAAGGATCTCGAGATCCTTACAGTCCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks