EMAIL THIS PAGE TO A FRIEND

SURF1

surfeit 1

UniProtKB ID: Q15526, Q5T8T3, Q5T8T4
Gene ID:
Human(6834) Summary: This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]
Mouse(20930) surfeit gene 1
Rat(64463) surfeit 1
cow(100139115) surfeit 1
sheep(101113488) surfeit 1
fruit fly(44498) Surfeit 1
dog(480681) surfeit 1
chicken(417157) surfeit 1
Zebrafish(557970) surfeit 1
Thale Cress(821310) Surfeit locus 1 cytochrome c oxidase biogenesis protein
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003172 Rosetta Predictions human pricing
NM_172068 Rosetta Predictions rat pricing
NM_013677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109195 predicted 541
2 SASI_Hs01_00109196 predicted 699
3 SASI_Hs01_00109197 predicted 508
4 SASI_Hs02_00335188 predicted 540
5 SASI_Hs01_00109199 predicted 605
6 SASI_Hs02_00335189 predicted 802
7 SASI_Hs02_00335190 predicted 709
8 SASI_Hs02_00335191 predicted 412
9 SASI_Hs01_00109202 predicted 725
10 SASI_Hs01_00109203 predicted 413
11 SASI_Hs01_00109198 predicted 412
12 SASI_Hs01_00109200 predicted 802
13 SASI_Hs01_00109201 predicted 579
14 SASI_Hs01_00109204 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074316 predicted 723
2 SASI_Rn01_00074317 predicted 287
3 SASI_Rn01_00074320 predicted 579
4 SASI_Rn01_00074321 predicted 298
5 SASI_Rn01_00074322 predicted 512
6 SASI_Rn01_00074323 predicted 305
7 SASI_Rn01_00074324 predicted 418
8 SASI_Rn01_00074325 predicted 504
9 SASI_Rn02_00269170 predicted 645
10 SASI_Rn02_00269171 predicted 469
11 SASI_Rn01_00074318 predicted 323
12 SASI_Rn01_00074319 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322537 predicted 376
2 SASI_Mm02_00322538 predicted 912
3 SASI_Mm01_00029630 predicted 585
4 SASI_Mm01_00029631 predicted 471
5 SASI_Mm01_00029633 predicted 727
6 SASI_Mm01_00029634 predicted 712
7 SASI_Mm01_00029635 predicted 888
8 SASI_Mm01_00029637 predicted 478
9 SASI_Mm01_00029638 predicted 483
10 SASI_Mm01_00029639 predicted 696
11 SASI_Mm01_00029632 predicted 388
12 SASI_Mm01_00029636 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003172
VALIDATED
SURF1 MISSION shRNA Bacterial Glycerol Stock
surfeit 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-760s21c1
Sequence:CCGGCCATCTTCATTGATGCCAACTCTCGAGAGTTGGCATCAATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-553s21c1
Sequence:CCGGCCATCCTGGTAAATAGAGGGTCTCGAGACCCTCTATTTACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-198s21c1
Sequence:CCGGGCGGAAGATGACTCCTTTCTTCTCGAGAAGAAAGGAGTCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-881s21c1
Sequence:CCGGAGCTACATCCTACCTGTGGTTCTCGAGAACCACAGGTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003172.2-849s1c1
Sequence:CCGGCAGTACATCGTGACCTGGTATCTCGAGATACCAGGTCACGATGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-198s1c1
Sequence:CCGGGCGGAAGATGACTCCTTTCTTCTCGAGAAGAAAGGAGTCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-760s1c1
Sequence:CCGGCCATCTTCATTGATGCCAACTCTCGAGAGTTGGCATCAATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-881s1c1
Sequence:CCGGAGCTACATCCTACCTGTGGTTCTCGAGAACCACAGGTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-553s1c1
Sequence:CCGGCCATCCTGGTAAATAGAGGGTCTCGAGACCCTCTATTTACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003172
VALIDATED
SURF1 MISSION shRNA shRNA Plasmid DNA
surfeit 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-760s21c1
Sequence:CCGGCCATCTTCATTGATGCCAACTCTCGAGAGTTGGCATCAATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-553s21c1
Sequence:CCGGCCATCCTGGTAAATAGAGGGTCTCGAGACCCTCTATTTACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-198s21c1
Sequence:CCGGGCGGAAGATGACTCCTTTCTTCTCGAGAAGAAAGGAGTCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-881s21c1
Sequence:CCGGAGCTACATCCTACCTGTGGTTCTCGAGAACCACAGGTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003172.2-849s1c1
Sequence:CCGGCAGTACATCGTGACCTGGTATCTCGAGATACCAGGTCACGATGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-198s1c1
Sequence:CCGGGCGGAAGATGACTCCTTTCTTCTCGAGAAGAAAGGAGTCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-760s1c1
Sequence:CCGGCCATCTTCATTGATGCCAACTCTCGAGAGTTGGCATCAATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-881s1c1
Sequence:CCGGAGCTACATCCTACCTGTGGTTCTCGAGAACCACAGGTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-553s1c1
Sequence:CCGGCCATCCTGGTAAATAGAGGGTCTCGAGACCCTCTATTTACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003172
VALIDATED
SURF1 MISSION shRNA Lentiviral Transduction Particles
surfeit 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-760s21c1
Sequence:CCGGCCATCTTCATTGATGCCAACTCTCGAGAGTTGGCATCAATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-553s21c1
Sequence:CCGGCCATCCTGGTAAATAGAGGGTCTCGAGACCCTCTATTTACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-198s21c1
Sequence:CCGGGCGGAAGATGACTCCTTTCTTCTCGAGAAGAAAGGAGTCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003172.2-881s21c1
Sequence:CCGGAGCTACATCCTACCTGTGGTTCTCGAGAACCACAGGTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003172.2-849s1c1
Sequence:CCGGCAGTACATCGTGACCTGGTATCTCGAGATACCAGGTCACGATGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-198s1c1
Sequence:CCGGGCGGAAGATGACTCCTTTCTTCTCGAGAAGAAAGGAGTCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-760s1c1
Sequence:CCGGCCATCTTCATTGATGCCAACTCTCGAGAGTTGGCATCAATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-881s1c1
Sequence:CCGGAGCTACATCCTACCTGTGGTTCTCGAGAACCACAGGTAGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003172.2-553s1c1
Sequence:CCGGCCATCCTGGTAAATAGAGGGTCTCGAGACCCTCTATTTACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013677
VALIDATED
SURF1 MISSION shRNA Bacterial Glycerol Stock
surfeit 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-912s21c1
Sequence:CCGGTGGAAGCTATGGCCAAGATAACTCGAGTTATCTTGGCCATAGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.2-732s1c1
Sequence:CCGGGAGTCACCATCCTGGTTAATACTCGAGTATTAACCAGGATGGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-472s21c1
Sequence:CCGGGAAATGGAAGCTGAAACTTATCTCGAGATAAGTTTCAGCTTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-732s21c1
Sequence:CCGGGAGTCACCATCCTGGTTAATACTCGAGTATTAACCAGGATGGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-884s21c1
Sequence:CCGGGAAAGGAATCACTGGTATTATCTCGAGATAATACCAGTGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-590s21c1
Sequence:CCGGGGCCACTTTGACCACTCTAAACTCGAGTTTAGAGTGGTCAAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-683s1c1
Sequence:CCGGCAGAAAGGAATCACTGGTATTCTCGAGAATACCAGTGATTCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-271s1c1
Sequence:CCGGCGGAAATGGAAGCTGAAACTTCTCGAGAAGTTTCAGCTTCCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-268s1c1
Sequence:CCGGCGTCGGAAATGGAAGCTGAAACTCGAGTTTCAGCTTCCATTTCCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013677
VALIDATED
SURF1 MISSION shRNA shRNA Plasmid DNA
surfeit 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-912s21c1
Sequence:CCGGTGGAAGCTATGGCCAAGATAACTCGAGTTATCTTGGCCATAGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.2-732s1c1
Sequence:CCGGGAGTCACCATCCTGGTTAATACTCGAGTATTAACCAGGATGGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-472s21c1
Sequence:CCGGGAAATGGAAGCTGAAACTTATCTCGAGATAAGTTTCAGCTTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-732s21c1
Sequence:CCGGGAGTCACCATCCTGGTTAATACTCGAGTATTAACCAGGATGGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-884s21c1
Sequence:CCGGGAAAGGAATCACTGGTATTATCTCGAGATAATACCAGTGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-590s21c1
Sequence:CCGGGGCCACTTTGACCACTCTAAACTCGAGTTTAGAGTGGTCAAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-683s1c1
Sequence:CCGGCAGAAAGGAATCACTGGTATTCTCGAGAATACCAGTGATTCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-271s1c1
Sequence:CCGGCGGAAATGGAAGCTGAAACTTCTCGAGAAGTTTCAGCTTCCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-268s1c1
Sequence:CCGGCGTCGGAAATGGAAGCTGAAACTCGAGTTTCAGCTTCCATTTCCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013677
VALIDATED
SURF1 MISSION shRNA Lentiviral Transduction Particles
surfeit 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-912s21c1
Sequence:CCGGTGGAAGCTATGGCCAAGATAACTCGAGTTATCTTGGCCATAGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.2-732s1c1
Sequence:CCGGGAGTCACCATCCTGGTTAATACTCGAGTATTAACCAGGATGGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-472s21c1
Sequence:CCGGGAAATGGAAGCTGAAACTTATCTCGAGATAAGTTTCAGCTTCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-732s21c1
Sequence:CCGGGAGTCACCATCCTGGTTAATACTCGAGTATTAACCAGGATGGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-884s21c1
Sequence:CCGGGAAAGGAATCACTGGTATTATCTCGAGATAATACCAGTGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_013677.2-590s21c1
Sequence:CCGGGGCCACTTTGACCACTCTAAACTCGAGTTTAGAGTGGTCAAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-683s1c1
Sequence:CCGGCAGAAAGGAATCACTGGTATTCTCGAGAATACCAGTGATTCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-271s1c1
Sequence:CCGGCGGAAATGGAAGCTGAAACTTCTCGAGAAGTTTCAGCTTCCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013677.1-268s1c1
Sequence:CCGGCGTCGGAAATGGAAGCTGAAACTCGAGTTTCAGCTTCCATTTCCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks