EMAIL THIS PAGE TO A FRIEND

SURF2

surfeit 2

Synonyms: SURF-2
UniProtKB ID: Q15527, Q6IBP9, Q96CD1
Gene ID:
Human(6835) Summary: This gene shares a bidirectional promoter with surfeit 1 (SURF1; GeneID: 6834), which is located on the opposite strand. It encodes a conserved protein that is expressed in a variety of tissues. [provided by RefSeq, Jul 2013]
Mouse(20931) surfeit gene 2
Rat(619345) surfeit 2
chicken(417156) surfeit 2
dog(491268) surfeit 2
cow(526046) surfeit 2
sheep(101113227) surfeit 2
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017503 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017503 Rosetta Predictions human pricing
NM_001033866 Rosetta Predictions rat pricing
NM_013678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130761 predicted 315
2 SASI_Hs01_00130763 predicted 539
3 SASI_Hs01_00130764 predicted 553
4 SASI_Hs01_00130766 predicted 551
5 SASI_Hs02_00350110 predicted 242
6 SASI_Hs02_00350111 predicted 364
7 SASI_Hs02_00350112 predicted 359
8 SASI_Hs01_00130769 predicted 548
9 SASI_Hs02_00350113 predicted 220
10 SASI_Hs02_00350114 predicted 481
11 SASI_Hs01_00130762 predicted 284
12 SASI_Hs01_00130765 predicted 277
13 SASI_Hs01_00130767 predicted 352
14 SASI_Hs01_00130768 predicted 520
15 SASI_Hs01_00130770 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203766 predicted 557
2 SASI_Rn01_00048061 predicted 233
3 SASI_Rn01_00048062 predicted 338
4 SASI_Rn01_00048063 predicted 396
5 SASI_Rn01_00048064 predicted 697
6 SASI_Rn01_00048065 predicted 736
7 SASI_Rn01_00048066 predicted 814
8 SASI_Rn01_00048067 predicted 795
9 SASI_Rn02_00203767 predicted 199
10 SASI_Rn01_00048069 predicted 411
11 SASI_Rn01_00048068 predicted 575
12 SASI_Rn01_00048070 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088066 predicted 218
2 SASI_Mm01_00088067 predicted 713
3 SASI_Mm01_00088068 predicted 744
4 SASI_Mm01_00088070 predicted 732
5 SASI_Mm01_00088071 predicted 814
6 SASI_Mm01_00088072 predicted 547
7 SASI_Mm01_00088073 predicted 249
8 SASI_Mm01_00088074 predicted 637
9 SASI_Mm01_00088075 predicted 359
10 SASI_Mm02_00322539 predicted 319
11 SASI_Mm01_00088069 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013678
VALIDATED
SURF2 MISSION shRNA Bacterial Glycerol Stock
surfeit 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013678.1-411s1c1
Sequence:CCGGCCAGACGAACAGTGATGAACTCTCGAGAGTTCATCACTGTTCGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-624s1c1
Sequence:CCGGGAAGAGCTTTAGAGAGAGGGACTCGAGTCCCTCTCTCTAAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-553s1c1
Sequence:CCGGCCTAAGAACGATGACACTCCTCTCGAGAGGAGTGTCATCGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-574s1c1
Sequence:CCGGGAAGACTTTCTGACAGACCAACTCGAGTTGGTCTGTCAGAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-495s1c1
Sequence:CCGGCGACAGCATGACAGACCTATACTCGAGTATAGGTCTGTCATGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-523s1c1
Sequence:CCGGGAGCTGTTCACAAAGAGAGAACTCGAGTTCTCTCTTTGTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-613s1c1
Sequence:CCGGCATTCAGAAGAGAAGAGCTTTCTCGAGAAAGCTCTTCTCTTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-179s1c1
Sequence:CCGGCTAACTTCGATTACGCAGCTTCTCGAGAAGCTGCGTAATCGAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-381s1c1
Sequence:CCGGCCTTCTACACAAGAGGAAGAACTCGAGTTCTTCCTCTTGTGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-509s21c1
Sequence:CCGGCGACAGCATGACAGACCTATACTCGAGTATAGGTCTGTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-425s21c1
Sequence:CCGGCCAGACGAACAGTGATGAACTCTCGAGAGTTCATCACTGTTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-638s21c1
Sequence:CCGGGAAGAGCTTTAGAGAGAGGGACTCGAGTCCCTCTCTCTAAAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-567s21c1
Sequence:CCGGCCTAAGAACGATGACACTCCTCTCGAGAGGAGTGTCATCGTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-588s21c1
Sequence:CCGGGAAGACTTTCTGACAGACCAACTCGAGTTGGTCTGTCAGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013678
VALIDATED
SURF2 MISSION shRNA shRNA Plasmid DNA
surfeit 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013678.1-411s1c1
Sequence:CCGGCCAGACGAACAGTGATGAACTCTCGAGAGTTCATCACTGTTCGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-624s1c1
Sequence:CCGGGAAGAGCTTTAGAGAGAGGGACTCGAGTCCCTCTCTCTAAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-553s1c1
Sequence:CCGGCCTAAGAACGATGACACTCCTCTCGAGAGGAGTGTCATCGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-574s1c1
Sequence:CCGGGAAGACTTTCTGACAGACCAACTCGAGTTGGTCTGTCAGAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-495s1c1
Sequence:CCGGCGACAGCATGACAGACCTATACTCGAGTATAGGTCTGTCATGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-523s1c1
Sequence:CCGGGAGCTGTTCACAAAGAGAGAACTCGAGTTCTCTCTTTGTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-613s1c1
Sequence:CCGGCATTCAGAAGAGAAGAGCTTTCTCGAGAAAGCTCTTCTCTTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-179s1c1
Sequence:CCGGCTAACTTCGATTACGCAGCTTCTCGAGAAGCTGCGTAATCGAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-381s1c1
Sequence:CCGGCCTTCTACACAAGAGGAAGAACTCGAGTTCTTCCTCTTGTGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-509s21c1
Sequence:CCGGCGACAGCATGACAGACCTATACTCGAGTATAGGTCTGTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-425s21c1
Sequence:CCGGCCAGACGAACAGTGATGAACTCTCGAGAGTTCATCACTGTTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-638s21c1
Sequence:CCGGGAAGAGCTTTAGAGAGAGGGACTCGAGTCCCTCTCTCTAAAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-567s21c1
Sequence:CCGGCCTAAGAACGATGACACTCCTCTCGAGAGGAGTGTCATCGTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-588s21c1
Sequence:CCGGGAAGACTTTCTGACAGACCAACTCGAGTTGGTCTGTCAGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013678
VALIDATED
SURF2 MISSION shRNA Lentiviral Transduction Particles
surfeit 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013678.1-411s1c1
Sequence:CCGGCCAGACGAACAGTGATGAACTCTCGAGAGTTCATCACTGTTCGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-624s1c1
Sequence:CCGGGAAGAGCTTTAGAGAGAGGGACTCGAGTCCCTCTCTCTAAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-553s1c1
Sequence:CCGGCCTAAGAACGATGACACTCCTCTCGAGAGGAGTGTCATCGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-574s1c1
Sequence:CCGGGAAGACTTTCTGACAGACCAACTCGAGTTGGTCTGTCAGAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013678.1-495s1c1
Sequence:CCGGCGACAGCATGACAGACCTATACTCGAGTATAGGTCTGTCATGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-523s1c1
Sequence:CCGGGAGCTGTTCACAAAGAGAGAACTCGAGTTCTCTCTTTGTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-613s1c1
Sequence:CCGGCATTCAGAAGAGAAGAGCTTTCTCGAGAAAGCTCTTCTCTTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-179s1c1
Sequence:CCGGCTAACTTCGATTACGCAGCTTCTCGAGAAGCTGCGTAATCGAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013678.1-381s1c1
Sequence:CCGGCCTTCTACACAAGAGGAAGAACTCGAGTTCTTCCTCTTGTGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-509s21c1
Sequence:CCGGCGACAGCATGACAGACCTATACTCGAGTATAGGTCTGTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-425s21c1
Sequence:CCGGCCAGACGAACAGTGATGAACTCTCGAGAGTTCATCACTGTTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-638s21c1
Sequence:CCGGGAAGAGCTTTAGAGAGAGGGACTCGAGTCCCTCTCTCTAAAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-567s21c1
Sequence:CCGGCCTAAGAACGATGACACTCCTCTCGAGAGGAGTGTCATCGTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013678.2-588s21c1
Sequence:CCGGGAAGACTTTCTGACAGACCAACTCGAGTTGGTCTGTCAGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017503
VALIDATED
SURF2 MISSION shRNA Bacterial Glycerol Stock
surfeit 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017503.2-308s1c1
Sequence:CCGGCATCAACAAGTGCCCAGAACACTCGAGTGTTCTGGGCACTTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-359s1c1
Sequence:CCGGCCAGCGAGCTCTGTGTAAATACTCGAGTATTTACACAGAGCTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-275s1c1
Sequence:CCGGGCACCAGTTGTTCTGCAAACTCTCGAGAGTTTGCAGAACAACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017503.2-629s1c1
Sequence:CCGGCAAAGAGGATGAGAAGGCAAACTCGAGTTTGCCTTCTCATCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-623s1c1
Sequence:CCGGGACAGACAAAGAGGATGAGAACTCGAGTTCTCATCCTCTTTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-564s1c1
Sequence:CCGGCTATTCACCAGAAAGGACCTTCTCGAGAAGGTCCTTTCTGGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017503.3-765s21c1
Sequence:CCGGCAAGAGTCATCACCGCAAACCCTCGAGGGTTTGCGGTGATGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017503.3-788s21c1
Sequence:CCGGAGAGCTTCAGCTCCTGTAAACCTCGAGGTTTACAGGAGCTGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017503
VALIDATED
SURF2 MISSION shRNA shRNA Plasmid DNA
surfeit 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017503.2-308s1c1
Sequence:CCGGCATCAACAAGTGCCCAGAACACTCGAGTGTTCTGGGCACTTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-359s1c1
Sequence:CCGGCCAGCGAGCTCTGTGTAAATACTCGAGTATTTACACAGAGCTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-275s1c1
Sequence:CCGGGCACCAGTTGTTCTGCAAACTCTCGAGAGTTTGCAGAACAACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017503.2-629s1c1
Sequence:CCGGCAAAGAGGATGAGAAGGCAAACTCGAGTTTGCCTTCTCATCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-623s1c1
Sequence:CCGGGACAGACAAAGAGGATGAGAACTCGAGTTCTCATCCTCTTTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-564s1c1
Sequence:CCGGCTATTCACCAGAAAGGACCTTCTCGAGAAGGTCCTTTCTGGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017503.3-765s21c1
Sequence:CCGGCAAGAGTCATCACCGCAAACCCTCGAGGGTTTGCGGTGATGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017503.3-788s21c1
Sequence:CCGGAGAGCTTCAGCTCCTGTAAACCTCGAGGTTTACAGGAGCTGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017503
VALIDATED
SURF2 MISSION shRNA Lentiviral Transduction Particles
surfeit 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017503.2-308s1c1
Sequence:CCGGCATCAACAAGTGCCCAGAACACTCGAGTGTTCTGGGCACTTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-359s1c1
Sequence:CCGGCCAGCGAGCTCTGTGTAAATACTCGAGTATTTACACAGAGCTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-275s1c1
Sequence:CCGGGCACCAGTTGTTCTGCAAACTCTCGAGAGTTTGCAGAACAACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017503.2-629s1c1
Sequence:CCGGCAAAGAGGATGAGAAGGCAAACTCGAGTTTGCCTTCTCATCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-623s1c1
Sequence:CCGGGACAGACAAAGAGGATGAGAACTCGAGTTCTCATCCTCTTTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017503.2-564s1c1
Sequence:CCGGCTATTCACCAGAAAGGACCTTCTCGAGAAGGTCCTTTCTGGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017503.3-765s21c1
Sequence:CCGGCAAGAGTCATCACCGCAAACCCTCGAGGGTTTGCGGTGATGACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017503.3-788s21c1
Sequence:CCGGAGAGCTTCAGCTCCTGTAAACCTCGAGGTTTACAGGAGCTGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks