EMAIL THIS PAGE TO A FRIEND

SURF4

surfeit 4

Synonyms: ERV29
UniProtKB ID: O15260, O60923, Q5T8U6, Q9UNZ0, Q9UNZ1
Gene ID:
Human(6836) Summary: This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein containing multiple putative transmembrane regions. In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). The specific function of this protein has not been determined but its yeast homolog is directly required for packaging glycosylated pro-alpha-factor into COPII vesicles. This gene uses multiple polyadenylation sites, resulting in transcript length variation. The existence of alternatively spliced transcript variants has been suggested, but their validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(20932) surfeit gene 4
Rat(619346) surfeit 4
cow(526045) surfeit 4
sheep(101112972) surfeit 4
fruit fly(41864) Surfeit 4
Zebrafish(394102) surfeit gene 4
dog(491269) surfeit 4
chicken(374273) surfeit 4
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033161 Rosetta Predictions human pricing
NM_001033868 Rosetta Predictions rat pricing
NM_011512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023743 predicted 441
2 SASI_Hs01_00023744 predicted 328
3 SASI_Hs01_00023745 predicted 753
4 SASI_Hs01_00023746 predicted 1287
5 SASI_Hs01_00023747 predicted 1372
6 SASI_Hs02_00360901 predicted 436
7 SASI_Hs01_00023748 predicted 1279
8 SASI_Hs01_00023749 predicted 764
9 SASI_Hs02_00360902 predicted 383
10 SASI_Hs01_00023750 predicted 641
11 SASI_Hs01_00023751 predicted 330
12 SASI_Hs01_00023752 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203770 predicted 425
2 SASI_Rn01_00056623 predicted 1104
3 SASI_Rn01_00056624 predicted 909
4 SASI_Rn01_00056625 predicted 418
5 SASI_Rn01_00056626 predicted 754
6 SASI_Rn01_00056627 predicted 794
7 SASI_Rn01_00056628 predicted 994
8 SASI_Rn01_00056630 predicted 686
9 SASI_Rn01_00056631 predicted 744
10 SASI_Rn01_00056632 predicted 846
11 SASI_Rn01_00056629 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074000 predicted 1229
2 SASI_Mm01_00074001 predicted 1766
3 SASI_Mm01_00074002 predicted 1889
4 SASI_Mm01_00074003 predicted 1821
5 SASI_Mm01_00074004 predicted 910
6 SASI_Mm01_00074005 predicted 1775
7 SASI_Mm01_00074006 predicted 1245
8 SASI_Mm01_00074007 predicted 1396
9 SASI_Mm01_00074008 predicted 973
10 SASI_Mm01_00074009 predicted 1265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011512
VALIDATED
SURF4 MISSION shRNA Bacterial Glycerol Stock
surfeit 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-748s21c1
Sequence:CCGGGGAGTGAGCAGCGTGACTATACTCGAGTATAGTCACGCTGCTCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1241s21c1
Sequence:CCGGGTTTGCCATCAACGTGTATTTCTCGAGAAATACACGTTGATGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1778s21c1
Sequence:CCGGCCTTAGCTCAAACTACTAAATCTCGAGATTTAGTAGTTTGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1270s21c1
Sequence:CCGGTCTGGACAATCCCGGTATATACTCGAGTATATACCGGGATTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-910s21c1
Sequence:CCGGCACTGCAGACAATTGCCTATACTCGAGTATAGGCAATTGTCTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1778s1c1
Sequence:CCGGCCTTAGCTCAAACTACTAAATCTCGAGATTTAGTAGTTTGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1304s1c1
Sequence:CCGGCTTCCTGAAATACGACTTCTTCTCGAGAAGAAGTCGTATTTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-938s1c1
Sequence:CCGGGTGGGACTTGAAGTTTCTCATCTCGAGATGAGAAACTTCAAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-861s1c1
Sequence:CCGGAGCAGGAACTTCGTGCAGTATCTCGAGATACTGCACGAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1281s1c1
Sequence:CCGGCCGGTATATAAACCCATGCATCTCGAGATGCATGGGTTTATATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011512
VALIDATED
SURF4 MISSION shRNA shRNA Plasmid DNA
surfeit 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-748s21c1
Sequence:CCGGGGAGTGAGCAGCGTGACTATACTCGAGTATAGTCACGCTGCTCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1241s21c1
Sequence:CCGGGTTTGCCATCAACGTGTATTTCTCGAGAAATACACGTTGATGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1778s21c1
Sequence:CCGGCCTTAGCTCAAACTACTAAATCTCGAGATTTAGTAGTTTGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1270s21c1
Sequence:CCGGTCTGGACAATCCCGGTATATACTCGAGTATATACCGGGATTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-910s21c1
Sequence:CCGGCACTGCAGACAATTGCCTATACTCGAGTATAGGCAATTGTCTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1778s1c1
Sequence:CCGGCCTTAGCTCAAACTACTAAATCTCGAGATTTAGTAGTTTGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1304s1c1
Sequence:CCGGCTTCCTGAAATACGACTTCTTCTCGAGAAGAAGTCGTATTTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-938s1c1
Sequence:CCGGGTGGGACTTGAAGTTTCTCATCTCGAGATGAGAAACTTCAAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-861s1c1
Sequence:CCGGAGCAGGAACTTCGTGCAGTATCTCGAGATACTGCACGAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1281s1c1
Sequence:CCGGCCGGTATATAAACCCATGCATCTCGAGATGCATGGGTTTATATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011512
VALIDATED
SURF4 MISSION shRNA Lentiviral Transduction Particles
surfeit 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-748s21c1
Sequence:CCGGGGAGTGAGCAGCGTGACTATACTCGAGTATAGTCACGCTGCTCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1241s21c1
Sequence:CCGGGTTTGCCATCAACGTGTATTTCTCGAGAAATACACGTTGATGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1778s21c1
Sequence:CCGGCCTTAGCTCAAACTACTAAATCTCGAGATTTAGTAGTTTGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-1270s21c1
Sequence:CCGGTCTGGACAATCCCGGTATATACTCGAGTATATACCGGGATTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011512.2-910s21c1
Sequence:CCGGCACTGCAGACAATTGCCTATACTCGAGTATAGGCAATTGTCTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1778s1c1
Sequence:CCGGCCTTAGCTCAAACTACTAAATCTCGAGATTTAGTAGTTTGAGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1304s1c1
Sequence:CCGGCTTCCTGAAATACGACTTCTTCTCGAGAAGAAGTCGTATTTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-938s1c1
Sequence:CCGGGTGGGACTTGAAGTTTCTCATCTCGAGATGAGAAACTTCAAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-861s1c1
Sequence:CCGGAGCAGGAACTTCGTGCAGTATCTCGAGATACTGCACGAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011512.2-1281s1c1
Sequence:CCGGCCGGTATATAAACCCATGCATCTCGAGATGCATGGGTTTATATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033161
VALIDATED
SURF4 MISSION shRNA Bacterial Glycerol Stock
surfeit 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-818s1c1
Sequence:CCGGCCCATGCATGACTTCCTGAAACTCGAGTTTCAGGAAGTCATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-440s1c1
Sequence:CCGGCAGACGATTGCCTACAGCATTCTCGAGAATGCTGTAGGCAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-737s1c1
Sequence:CCGGCTGGCTGCTTTGACTCTTGTTCTCGAGAACAAGAGTCAAAGCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033161.2-802s1c1
Sequence:CCGGCATTCCAGTCTACAAGCCCATCTCGAGATGGGCTTGTAGACTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-412s1c1
Sequence:CCGGCTTCGGGCTCTTTGGAATCATCTCGAGATGATTCCAAAGAGCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-629s1c1
Sequence:CCGGCTGATGTTCATGACCCTCCTTCTCGAGAAGGAGGGTCATGAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-1427s1c1
Sequence:CCGGCCAGTGGCTTTGATGTTGTTTCTCGAGAAACAACATCAAAGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-763s1c1
Sequence:CCGGGCTCTTTGCCATCAACGTATACTCGAGTATACGTTGATGGCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-2155s1c1
Sequence:CCGGGCACCATAGTAAATGCCACAACTCGAGTTGTGGCATTTACTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-1495s1c1
Sequence:CCGGCCCAAAGAATGATGCAGTATTCTCGAGAATACTGCATCATTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-820s1c1
Sequence:CCGGCATGCATGACTTCCTGAAATACTCGAGTATTTCAGGAAGTCATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033161
VALIDATED
SURF4 MISSION shRNA shRNA Plasmid DNA
surfeit 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-818s1c1
Sequence:CCGGCCCATGCATGACTTCCTGAAACTCGAGTTTCAGGAAGTCATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-440s1c1
Sequence:CCGGCAGACGATTGCCTACAGCATTCTCGAGAATGCTGTAGGCAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-737s1c1
Sequence:CCGGCTGGCTGCTTTGACTCTTGTTCTCGAGAACAAGAGTCAAAGCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033161.2-802s1c1
Sequence:CCGGCATTCCAGTCTACAAGCCCATCTCGAGATGGGCTTGTAGACTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-412s1c1
Sequence:CCGGCTTCGGGCTCTTTGGAATCATCTCGAGATGATTCCAAAGAGCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-629s1c1
Sequence:CCGGCTGATGTTCATGACCCTCCTTCTCGAGAAGGAGGGTCATGAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-1427s1c1
Sequence:CCGGCCAGTGGCTTTGATGTTGTTTCTCGAGAAACAACATCAAAGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-763s1c1
Sequence:CCGGGCTCTTTGCCATCAACGTATACTCGAGTATACGTTGATGGCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-2155s1c1
Sequence:CCGGGCACCATAGTAAATGCCACAACTCGAGTTGTGGCATTTACTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-1495s1c1
Sequence:CCGGCCCAAAGAATGATGCAGTATTCTCGAGAATACTGCATCATTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-820s1c1
Sequence:CCGGCATGCATGACTTCCTGAAATACTCGAGTATTTCAGGAAGTCATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033161
VALIDATED
SURF4 MISSION shRNA Lentiviral Transduction Particles
surfeit 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-818s1c1
Sequence:CCGGCCCATGCATGACTTCCTGAAACTCGAGTTTCAGGAAGTCATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-440s1c1
Sequence:CCGGCAGACGATTGCCTACAGCATTCTCGAGAATGCTGTAGGCAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-737s1c1
Sequence:CCGGCTGGCTGCTTTGACTCTTGTTCTCGAGAACAAGAGTCAAAGCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033161.2-802s1c1
Sequence:CCGGCATTCCAGTCTACAAGCCCATCTCGAGATGGGCTTGTAGACTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-412s1c1
Sequence:CCGGCTTCGGGCTCTTTGGAATCATCTCGAGATGATTCCAAAGAGCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-629s1c1
Sequence:CCGGCTGATGTTCATGACCCTCCTTCTCGAGAAGGAGGGTCATGAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-1427s1c1
Sequence:CCGGCCAGTGGCTTTGATGTTGTTTCTCGAGAAACAACATCAAAGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-763s1c1
Sequence:CCGGGCTCTTTGCCATCAACGTATACTCGAGTATACGTTGATGGCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-2155s1c1
Sequence:CCGGGCACCATAGTAAATGCCACAACTCGAGTTGTGGCATTTACTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033161.2-1495s1c1
Sequence:CCGGCCCAAAGAATGATGCAGTATTCTCGAGAATACTGCATCATTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033161.2-820s1c1
Sequence:CCGGCATGCATGACTTCCTGAAATACTCGAGTATTTCAGGAAGTCATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks