EMAIL THIS PAGE TO A FRIEND

SURF6

surfeit 6

Synonyms: RRP14
UniProtKB ID: O75683, Q5T8U1, Q9BRK9, Q9BTZ5, Q9UK24
Gene ID:
Human(6838) Summary: This gene encodes a conserved protein that is localized to the nucleolus. The encoded protein may function as a nucleolar-matrix protein with nucleic acid-binding properties. There is a pseudogene for this gene on chromosome Y. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(20935) surfeit gene 6
Rat(303076) surfeit 6
fruit fly(42370) Surfeit 6
dog(607893) surfeit 6
dog(485740) surfeit locus protein 6-like
Zebrafish(394040) surfeit 6
chicken(417160) surfeit 6
cow(511610) surfeit 6
sheep(101113749) surfeit 6
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006753 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006753 Rosetta Predictions human pricing
NM_001015014 Rosetta Predictions rat pricing
XM_220344 Rosetta Predictions rat pricing
NM_009298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216234 predicted 1332
2 SASI_Hs02_00342229 predicted 1281
3 SASI_Hs01_00216235 predicted 658
4 SASI_Hs01_00216236 predicted 545
5 SASI_Hs01_00216237 predicted 881
6 SASI_Hs01_00216238 predicted 1283
7 SASI_Hs01_00216239 predicted 1342
8 SASI_Hs01_00216240 predicted 701
9 SASI_Hs01_00216241 predicted 912
10 SASI_Hs01_00216242 predicted 1309
11 SASI_Hs01_00216243 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070530 predicted 598
2 SASI_Rn01_00070531 predicted 648
3 SASI_Rn01_00070532 predicted 591
4 SASI_Rn02_00202011 predicted 698
5 SASI_Rn01_00070534 predicted 222
6 SASI_Rn01_00070535 predicted 851
7 SASI_Rn01_00070536 predicted 363
8 SASI_Rn02_00202012 predicted 580
9 SASI_Rn01_00070537 predicted 818
10 SASI_Rn01_00070538 predicted 343
11 SASI_Rn01_00070533 predicted 776
12 SASI_Rn01_00070539 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143717 predicted 341
2 SASI_Rn01_00143718 predicted 437
3 SASI_Rn01_00143719 predicted 471
4 SASI_Rn01_00143720 predicted 264
5 SASI_Rn01_00143721 predicted 339
6 SASI_Rn01_00143722 predicted 257
7 SASI_Rn01_00143723 predicted 218
8 SASI_Rn01_00143724 predicted 364
9 SASI_Rn01_00143725 predicted 280
10 SASI_Rn01_00143726 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168338 predicted 581
2 SASI_Mm01_00168339 predicted 1156
3 SASI_Mm01_00168340 predicted 203
4 SASI_Mm01_00168341 predicted 585
5 SASI_Mm01_00168343 predicted 841
6 SASI_Mm01_00168344 predicted 1358
7 SASI_Mm02_00315824 predicted 1519
8 SASI_Mm01_00168345 predicted 1232
9 SASI_Mm02_00315825 predicted 1527
10 SASI_Mm01_00168346 predicted 1028
11 SASI_Mm01_00168342 predicted 247
12 SASI_Mm01_00168347 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006753
VALIDATED
SURF6 MISSION shRNA Bacterial Glycerol Stock
surfeit 6
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147182    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006753.3-2149s1c1
Sequence:CCGGCAGACACAACAGTATCTGAAACTCGAGTTTCAGATACTGTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006753.3-120s1c1
Sequence:CCGGCAAGAAGATCTGCTCCCATTCCTCGAGGAATGGGAGCAGATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006753.3-663s1c1
Sequence:CCGGCGGGCTGATCTTCAATAAGGTCTCGAGACCTTATTGAAGATCAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006753.3-666s1c1
Sequence:CCGGGCTGATCTTCAATAAGGTGGACTCGAGTCCACCTTATTGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006753.3-400s1c1
Sequence:CCGGGAGTCTGTCTTTGCTCTGGATCTCGAGATCCAGAGCAAAGACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1187s21c1
Sequence:CCGGGTCTTCCGTCCTAGGAGACTCCTCGAGGAGTCTCCTAGGACGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1302s21c1
Sequence:CCGGGAGTTGTGAGGGCCCAGATCACTCGAGTGATCTGGGCCCTCACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1286s21c1
Sequence:CCGGACAGTGGTGCTCTGCTGAGTTCTCGAGAACTCAGCAGAGCACCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1346s21c1
Sequence:CCGGAGTTTCAGCGTCATCCTTGAACTCGAGTTCAAGGATGACGCTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1210s21c1
Sequence:CCGGGGACACCCTCTGAGTCCTTGACTCGAGTCAAGGACTCAGAGGGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-887s21c1
Sequence:CCGGGGACCAACCTCCTCTACAAGGCTCGAGCCTTGTAGAGGAGGTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1379s21c1
Sequence:CCGGGACCTTCAGACCCAGGGAAAGCTCGAGCTTTCCCTGGGTCTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-434s21c1
Sequence:CCGGAGCGACTGCATGAGAAGATCCCTCGAGGGATCTTCTCATGCAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-240s21c1
Sequence:CCGGATTCCGGAAGCGAGAAGAGAACTCGAGTTCTCTTCTCGCTTCCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-917s21c1
Sequence:CCGGTGAAGATCCGTGACGACGAACCTCGAGGTTCGTCGTCACGGATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1332s21c1
Sequence:CCGGTGTGAGAAAGAGAGAGTTTCACTCGAGTGAAACTCTCTCTTTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006753
VALIDATED
SURF6 MISSION shRNA shRNA Plasmid DNA
surfeit 6
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147182    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006753.3-2149s1c1
Sequence:CCGGCAGACACAACAGTATCTGAAACTCGAGTTTCAGATACTGTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006753.3-120s1c1
Sequence:CCGGCAAGAAGATCTGCTCCCATTCCTCGAGGAATGGGAGCAGATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006753.3-663s1c1
Sequence:CCGGCGGGCTGATCTTCAATAAGGTCTCGAGACCTTATTGAAGATCAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006753.3-666s1c1
Sequence:CCGGGCTGATCTTCAATAAGGTGGACTCGAGTCCACCTTATTGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006753.3-400s1c1
Sequence:CCGGGAGTCTGTCTTTGCTCTGGATCTCGAGATCCAGAGCAAAGACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1187s21c1
Sequence:CCGGGTCTTCCGTCCTAGGAGACTCCTCGAGGAGTCTCCTAGGACGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1302s21c1
Sequence:CCGGGAGTTGTGAGGGCCCAGATCACTCGAGTGATCTGGGCCCTCACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1286s21c1
Sequence:CCGGACAGTGGTGCTCTGCTGAGTTCTCGAGAACTCAGCAGAGCACCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1346s21c1
Sequence:CCGGAGTTTCAGCGTCATCCTTGAACTCGAGTTCAAGGATGACGCTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1210s21c1
Sequence:CCGGGGACACCCTCTGAGTCCTTGACTCGAGTCAAGGACTCAGAGGGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-887s21c1
Sequence:CCGGGGACCAACCTCCTCTACAAGGCTCGAGCCTTGTAGAGGAGGTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1379s21c1
Sequence:CCGGGACCTTCAGACCCAGGGAAAGCTCGAGCTTTCCCTGGGTCTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-434s21c1
Sequence:CCGGAGCGACTGCATGAGAAGATCCCTCGAGGGATCTTCTCATGCAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-240s21c1
Sequence:CCGGATTCCGGAAGCGAGAAGAGAACTCGAGTTCTCTTCTCGCTTCCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-917s21c1
Sequence:CCGGTGAAGATCCGTGACGACGAACCTCGAGGTTCGTCGTCACGGATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1332s21c1
Sequence:CCGGTGTGAGAAAGAGAGAGTTTCACTCGAGTGAAACTCTCTCTTTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006753
VALIDATED
SURF6 MISSION shRNA Lentiviral Transduction Particles
surfeit 6
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147182    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006753.3-2149s1c1
Sequence:CCGGCAGACACAACAGTATCTGAAACTCGAGTTTCAGATACTGTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006753.3-120s1c1
Sequence:CCGGCAAGAAGATCTGCTCCCATTCCTCGAGGAATGGGAGCAGATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006753.3-663s1c1
Sequence:CCGGCGGGCTGATCTTCAATAAGGTCTCGAGACCTTATTGAAGATCAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006753.3-666s1c1
Sequence:CCGGGCTGATCTTCAATAAGGTGGACTCGAGTCCACCTTATTGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006753.3-400s1c1
Sequence:CCGGGAGTCTGTCTTTGCTCTGGATCTCGAGATCCAGAGCAAAGACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1187s21c1
Sequence:CCGGGTCTTCCGTCCTAGGAGACTCCTCGAGGAGTCTCCTAGGACGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1302s21c1
Sequence:CCGGGAGTTGTGAGGGCCCAGATCACTCGAGTGATCTGGGCCCTCACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1286s21c1
Sequence:CCGGACAGTGGTGCTCTGCTGAGTTCTCGAGAACTCAGCAGAGCACCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1346s21c1
Sequence:CCGGAGTTTCAGCGTCATCCTTGAACTCGAGTTCAAGGATGACGCTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1210s21c1
Sequence:CCGGGGACACCCTCTGAGTCCTTGACTCGAGTCAAGGACTCAGAGGGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-887s21c1
Sequence:CCGGGGACCAACCTCCTCTACAAGGCTCGAGCCTTGTAGAGGAGGTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1379s21c1
Sequence:CCGGGACCTTCAGACCCAGGGAAAGCTCGAGCTTTCCCTGGGTCTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-434s21c1
Sequence:CCGGAGCGACTGCATGAGAAGATCCCTCGAGGGATCTTCTCATGCAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-240s21c1
Sequence:CCGGATTCCGGAAGCGAGAAGAGAACTCGAGTTCTCTTCTCGCTTCCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006753.4-917s21c1
Sequence:CCGGTGAAGATCCGTGACGACGAACCTCGAGGTTCGTCGTCACGGATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006753.4-1332s21c1
Sequence:CCGGTGTGAGAAAGAGAGAGTTTCACTCGAGTGAAACTCTCTCTTTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009298
VALIDATED
SURF6 MISSION shRNA Bacterial Glycerol Stock
surfeit 6
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-853s1c1
Sequence:CCGGCAAGATGAAGTGGACCAACTTCTCGAGAAGTTGGTCCACTTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-1840s1c1
Sequence:CCGGGCGCTTATTAAAGATGTGGTACTCGAGTACCACATCTTTAATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-703s1c1
Sequence:CCGGCAAGAAGGAGAAGAGGCAGAACTCGAGTTCTGCCTCTTCTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-245s1c1
Sequence:CCGGCAGGAACAGAAAGCTATGGATCTCGAGATCCATAGCTTTCTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009298.2-2485s1c1
Sequence:CCGGGCACTGGAGTAAGAGTCATTACTCGAGTAATGACTCTTACTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009298.2-257s1c1
Sequence:CCGGGCTATGGATCACAAGACTAAACTCGAGTTTAGTCTTGTGATCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009298.3-1271s21c1
Sequence:CCGGTGTTTCATCAGCATCTTTAAGCTCGAGCTTAAAGATGCTGATGAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-198s21c1
Sequence:CCGGCAGGAACAGAAAGCTATGGATCTCGAGATCCATAGCTTTCTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-589s21c1
Sequence:CCGGAGGAATCAGGGCTGATCTTTACTCGAGTAAAGATCAGCCCTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-656s21c1
Sequence:CCGGCAAGAAGGAGAAGAGGCAGAACTCGAGTTCTGCCTCTTCTCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-806s21c1
Sequence:CCGGCAAGATGAAGTGGACCAACTTCTCGAGAAGTTGGTCCACTTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009298
VALIDATED
SURF6 MISSION shRNA shRNA Plasmid DNA
surfeit 6
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-853s1c1
Sequence:CCGGCAAGATGAAGTGGACCAACTTCTCGAGAAGTTGGTCCACTTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-1840s1c1
Sequence:CCGGGCGCTTATTAAAGATGTGGTACTCGAGTACCACATCTTTAATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-703s1c1
Sequence:CCGGCAAGAAGGAGAAGAGGCAGAACTCGAGTTCTGCCTCTTCTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-245s1c1
Sequence:CCGGCAGGAACAGAAAGCTATGGATCTCGAGATCCATAGCTTTCTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009298.2-2485s1c1
Sequence:CCGGGCACTGGAGTAAGAGTCATTACTCGAGTAATGACTCTTACTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009298.2-257s1c1
Sequence:CCGGGCTATGGATCACAAGACTAAACTCGAGTTTAGTCTTGTGATCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009298.3-1271s21c1
Sequence:CCGGTGTTTCATCAGCATCTTTAAGCTCGAGCTTAAAGATGCTGATGAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-198s21c1
Sequence:CCGGCAGGAACAGAAAGCTATGGATCTCGAGATCCATAGCTTTCTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-589s21c1
Sequence:CCGGAGGAATCAGGGCTGATCTTTACTCGAGTAAAGATCAGCCCTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-656s21c1
Sequence:CCGGCAAGAAGGAGAAGAGGCAGAACTCGAGTTCTGCCTCTTCTCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-806s21c1
Sequence:CCGGCAAGATGAAGTGGACCAACTTCTCGAGAAGTTGGTCCACTTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009298
VALIDATED
SURF6 MISSION shRNA Lentiviral Transduction Particles
surfeit 6
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-853s1c1
Sequence:CCGGCAAGATGAAGTGGACCAACTTCTCGAGAAGTTGGTCCACTTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-1840s1c1
Sequence:CCGGGCGCTTATTAAAGATGTGGTACTCGAGTACCACATCTTTAATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-703s1c1
Sequence:CCGGCAAGAAGGAGAAGAGGCAGAACTCGAGTTCTGCCTCTTCTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009298.2-245s1c1
Sequence:CCGGCAGGAACAGAAAGCTATGGATCTCGAGATCCATAGCTTTCTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009298.2-2485s1c1
Sequence:CCGGGCACTGGAGTAAGAGTCATTACTCGAGTAATGACTCTTACTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009298.2-257s1c1
Sequence:CCGGGCTATGGATCACAAGACTAAACTCGAGTTTAGTCTTGTGATCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009298.3-1271s21c1
Sequence:CCGGTGTTTCATCAGCATCTTTAAGCTCGAGCTTAAAGATGCTGATGAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-198s21c1
Sequence:CCGGCAGGAACAGAAAGCTATGGATCTCGAGATCCATAGCTTTCTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-589s21c1
Sequence:CCGGAGGAATCAGGGCTGATCTTTACTCGAGTAAAGATCAGCCCTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-656s21c1
Sequence:CCGGCAAGAAGGAGAAGAGGCAGAACTCGAGTTCTGCCTCTTCTCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009298.3-806s21c1
Sequence:CCGGCAAGATGAAGTGGACCAACTTCTCGAGAAGTTGGTCCACTTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks