EMAIL THIS PAGE TO A FRIEND

SUSD1

sushi domain containing 1

Gene ID:
Mouse(634731) sushi domain containing 1
Rat(298031) sushi domain containing 1
chicken(427334) sushi domain containing 1
dog(481667) sushi domain containing 1
domestic cat(101093970) sushi domain containing 1
Horse(100057493) sushi domain containing 1
cow(518850) sushi domain containing 1
sheep(101121153) sushi domain containing 1
naked mole-rat(101714737) sushi domain containing 1
domestic guinea pig(100716696) sushi domain containing 1
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA048554 Anti-SUSD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022486 Rosetta Predictions human pricing
NM_001106650 Rosetta Predictions rat pricing
XM_909547 Rosetta Predictions mouse pricing
XM_988632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214191 predicted 1128
2 SASI_Hs01_00214192 predicted 1303
3 SASI_Hs01_00214193 predicted 354
4 SASI_Hs01_00214195 predicted 1362
5 SASI_Hs02_00355778 predicted 2014
6 SASI_Hs01_00214196 predicted 370
7 SASI_Hs01_00214197 predicted 1225
8 SASI_Hs02_00355779 predicted 2342
9 SASI_Hs01_00214198 predicted 1399
10 SASI_Hs02_00355780 predicted 2181
11 SASI_Hs01_00214194 predicted 1584
12 SASI_Hs01_00214199 predicted 1338
13 SASI_Hs01_00214200 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221038 predicted 981
2 SASI_Rn02_00221039 predicted 277
3 SASI_Rn02_00221040 predicted 841
4 SASI_Rn02_00221041 predicted 501
5 SASI_Rn02_00221042 predicted 545
6 SASI_Rn02_00221043 predicted 757
7 SASI_Rn02_00221044 predicted 831
8 SASI_Rn02_00221045 predicted 322
9 SASI_Rn02_00221046 predicted 680
10 SASI_Rn02_00221047 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434880 predicted 1858
2 SASI_Mm02_00434881 predicted 1184
3 SASI_Mm02_00434882 predicted 1637
4 SASI_Mm02_00434883 predicted 1703
5 SASI_Mm02_00434884 predicted 921
6 SASI_Mm02_00434885 predicted 488
7 SASI_Mm02_00434886 predicted 2253
8 SASI_Mm02_00434887 predicted 1494
9 SASI_Mm02_00434888 predicted 481
10 SASI_Mm02_00434889 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244812 predicted 1860
2 SASI_Mm02_00449717 predicted 1995
3 SASI_Mm02_00449718 predicted 1849
4 SASI_Mm01_00244814 predicted 1869
5 SASI_Mm02_00449719 predicted 2070
6 SASI_Mm02_00449720 predicted 1922
7 SASI_Mm02_00449721 predicted 2148
8 SASI_Mm02_00449722 predicted 2122
9 SASI_Mm02_00449723 predicted 1907
10 SASI_Mm02_00449724 predicted 2032
11 SASI_Mm01_00244813 predicted 2440
12 SASI_Mm01_00244815 predicted 1713
13 SASI_Mm01_00244816 predicted 491
14 SASI_Mm01_00244817 predicted 2431
15 SASI_Mm01_00244818 predicted 1502
16 SASI_Mm01_00244819 predicted 1928
17 SASI_Mm01_00244820 predicted 1564
18 SASI_Mm01_00244821 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022486
VALIDATED
SUSD1 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-1474s21c1
Sequence:CCGGAGCGGCACTCAGTGCAAATAACTCGAGTTATTTGCACTGAGTGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-1423s21c1
Sequence:CCGGTGTACCCTACGACTGATTATACTCGAGTATAATCAGTCGTAGGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-205s21c1
Sequence:CCGGAGATCTGTATTTGCAACTATGCTCGAGCATAGTTGCAAATACAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-2105s21c1
Sequence:CCGGGAGTGATTACTGCATTATATTCTCGAGAATATAATGCAGTAATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022486.3-2758s21c1
Sequence:CCGGACTTTATGAAGGAGGTCATTGCTCGAGCAATGACCTCCTTCATAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-1584s1c1
Sequence:CCGGGCTGATATGGAGGAGATGTATCTCGAGATACATCTCCTCCATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-2128s1c1
Sequence:CCGGGAATCACAAGTGAATGGAATACTCGAGTATTCCATTCACTTGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-562s1c1
Sequence:CCGGGCACAGAAATAGACTGTGGTACTCGAGTACCACAGTCTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-970s1c1
Sequence:CCGGCCTGTGTGAGATGGCAAATAACTCGAGTTATTTGCCATCTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-1209s1c1
Sequence:CCGGGCTGAAGTTGATCTCTTAGAACTCGAGTTCTAAGAGATCAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022486
VALIDATED
SUSD1 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-1474s21c1
Sequence:CCGGAGCGGCACTCAGTGCAAATAACTCGAGTTATTTGCACTGAGTGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-1423s21c1
Sequence:CCGGTGTACCCTACGACTGATTATACTCGAGTATAATCAGTCGTAGGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-205s21c1
Sequence:CCGGAGATCTGTATTTGCAACTATGCTCGAGCATAGTTGCAAATACAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-2105s21c1
Sequence:CCGGGAGTGATTACTGCATTATATTCTCGAGAATATAATGCAGTAATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022486.3-2758s21c1
Sequence:CCGGACTTTATGAAGGAGGTCATTGCTCGAGCAATGACCTCCTTCATAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-1584s1c1
Sequence:CCGGGCTGATATGGAGGAGATGTATCTCGAGATACATCTCCTCCATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-2128s1c1
Sequence:CCGGGAATCACAAGTGAATGGAATACTCGAGTATTCCATTCACTTGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-562s1c1
Sequence:CCGGGCACAGAAATAGACTGTGGTACTCGAGTACCACAGTCTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-970s1c1
Sequence:CCGGCCTGTGTGAGATGGCAAATAACTCGAGTTATTTGCCATCTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-1209s1c1
Sequence:CCGGGCTGAAGTTGATCTCTTAGAACTCGAGTTCTAAGAGATCAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022486
VALIDATED
SUSD1 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-1474s21c1
Sequence:CCGGAGCGGCACTCAGTGCAAATAACTCGAGTTATTTGCACTGAGTGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-1423s21c1
Sequence:CCGGTGTACCCTACGACTGATTATACTCGAGTATAATCAGTCGTAGGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-205s21c1
Sequence:CCGGAGATCTGTATTTGCAACTATGCTCGAGCATAGTTGCAAATACAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022486.3-2105s21c1
Sequence:CCGGGAGTGATTACTGCATTATATTCTCGAGAATATAATGCAGTAATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022486.3-2758s21c1
Sequence:CCGGACTTTATGAAGGAGGTCATTGCTCGAGCAATGACCTCCTTCATAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-1584s1c1
Sequence:CCGGGCTGATATGGAGGAGATGTATCTCGAGATACATCTCCTCCATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-2128s1c1
Sequence:CCGGGAATCACAAGTGAATGGAATACTCGAGTATTCCATTCACTTGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-562s1c1
Sequence:CCGGGCACAGAAATAGACTGTGGTACTCGAGTACCACAGTCTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-970s1c1
Sequence:CCGGCCTGTGTGAGATGGCAAATAACTCGAGTTATTTGCCATCTCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022486.2-1209s1c1
Sequence:CCGGGCTGAAGTTGATCTCTTAGAACTCGAGTTCTAAGAGATCAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163288
VALIDATED
SUSD1 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1742s21c1
Sequence:CCGGCTCCGCACAAATAACCATAACCTCGAGGTTATGGTTATTTGTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1789s21c1
Sequence:CCGGTCGCTAATATTTCGGTATATACTCGAGTATATACCGAAATATTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1690s21c1
Sequence:CCGGCCGCTACTGATTACACGATAACTCGAGTTATCGTGTAATCAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163288.1-1280s21c1
Sequence:CCGGGTACTTGATACGCGTTGAAAGCTCGAGCTTTCAACGCGTATCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163288.1-2668s21c1
Sequence:CCGGCATGACCTCATTCCTGAATTTCTCGAGAAATTCAGGAATGAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163288
VALIDATED
SUSD1 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1742s21c1
Sequence:CCGGCTCCGCACAAATAACCATAACCTCGAGGTTATGGTTATTTGTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1789s21c1
Sequence:CCGGTCGCTAATATTTCGGTATATACTCGAGTATATACCGAAATATTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1690s21c1
Sequence:CCGGCCGCTACTGATTACACGATAACTCGAGTTATCGTGTAATCAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163288.1-1280s21c1
Sequence:CCGGGTACTTGATACGCGTTGAAAGCTCGAGCTTTCAACGCGTATCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163288.1-2668s21c1
Sequence:CCGGCATGACCTCATTCCTGAATTTCTCGAGAAATTCAGGAATGAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163288
VALIDATED
SUSD1 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1742s21c1
Sequence:CCGGCTCCGCACAAATAACCATAACCTCGAGGTTATGGTTATTTGTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1789s21c1
Sequence:CCGGTCGCTAATATTTCGGTATATACTCGAGTATATACCGAAATATTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163288.1-1690s21c1
Sequence:CCGGCCGCTACTGATTACACGATAACTCGAGTTATCGTGTAATCAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163288.1-1280s21c1
Sequence:CCGGGTACTTGATACGCGTTGAAAGCTCGAGCTTTCAACGCGTATCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163288.1-2668s21c1
Sequence:CCGGCATGACCTCATTCCTGAATTTCTCGAGAAATTCAGGAATGAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks