EMAIL THIS PAGE TO A FRIEND

SUSD3

sushi domain containing 3

UniProtKB ID: Q96L08, Q49AA6, Q6UXV7
Gene ID:
Mouse(66329) sushi domain containing 3
Rat(306810) sushi domain containing 3
chicken(415988) sushi domain containing 3
dog(610607) sushi domain containing 3
domestic cat(101092152) sushi domain containing 3
cow(512524) sushi domain containing 3
sheep(101107410) sushi domain containing 3
naked mole-rat(101725277) sushi domain containing 3
domestic guinea pig(100723085) sushi domain containing 3
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145006 Rosetta Predictions human pricing
NM_001107341 Rosetta Predictions rat pricing
NM_025491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211166 predicted 769
2 SASI_Hs01_00211167 predicted 318
3 SASI_Hs01_00211168 predicted 347
4 SASI_Hs01_00211169 predicted 346
5 SASI_Hs01_00211171 predicted 618
6 SASI_Hs01_00211172 predicted 766
7 SASI_Hs02_00364846 predicted 854
8 SASI_Hs01_00211173 predicted 607
9 SASI_Hs01_00211174 predicted 515
10 SASI_Hs01_00211175 predicted 565
11 SASI_Hs01_00211170 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227875 predicted 930
2 SASI_Rn02_00227876 predicted 519
3 SASI_Rn02_00227877 predicted 685
4 SASI_Rn02_00227878 predicted 1049
5 SASI_Rn02_00227879 predicted 333
6 SASI_Rn02_00227880 predicted 342
7 SASI_Rn02_00227881 predicted 616
8 SASI_Rn02_00227882 predicted 507
9 SASI_Rn02_00227883 predicted 754
10 SASI_Rn02_00227884 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148795 predicted 317
2 SASI_Mm01_00148796 predicted 329
3 SASI_Mm01_00148797 predicted 887
4 SASI_Mm01_00148798 predicted 683
5 SASI_Mm01_00148799 predicted 514
6 SASI_Mm01_00148800 predicted 316
7 SASI_Mm01_00148801 predicted 470
8 SASI_Mm01_00148802 predicted 746
9 SASI_Mm01_00148804 predicted 851
10 SASI_Mm01_00148803 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145006
SUSD3 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145006.2-166s21c1
Sequence:CCGGCAAGTCCTTCGTGGCAATGGTCTCGAGACCATTGCCACGAAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145006.2-274s21c1
Sequence:CCGGAGCATCGCTGAGTGGTCTTCACTCGAGTGAAGACCACTCAGCGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145006.2-992s21c1
Sequence:CCGGAGTGTTCTGTTCCGGCATATCCTCGAGGATATGCCGGAACAGAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145006.2-905s21c1
Sequence:CCGGTCGAGACTGATGAGTGGAATCCTCGAGGATTCCACTCATCAGTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145006.2-864s1c1
Sequence:CCGGCAGTCAGCTACAACTCCACATCTCGAGATGTGGAGTTGTAGCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-483s1c1
Sequence:CCGGGCTGAAAGATGAGGACTTGGACTCGAGTCCAAGTCCTCATCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-531s1c1
Sequence:CCGGCAAGCACTTCAACAAACCCGTCTCGAGACGGGTTTGTTGAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-316s1c1
Sequence:CCGGGTGCCACCACACGAGACCTTTCTCGAGAAAGGTCTCGTGTGGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145006.2-1048s1c1
Sequence:CCGGGAAACCACTACTGAGGGTAATCTCGAGATTACCCTCAGTAGTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145006
SUSD3 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145006.2-166s21c1
Sequence:CCGGCAAGTCCTTCGTGGCAATGGTCTCGAGACCATTGCCACGAAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145006.2-274s21c1
Sequence:CCGGAGCATCGCTGAGTGGTCTTCACTCGAGTGAAGACCACTCAGCGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145006.2-992s21c1
Sequence:CCGGAGTGTTCTGTTCCGGCATATCCTCGAGGATATGCCGGAACAGAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145006.2-905s21c1
Sequence:CCGGTCGAGACTGATGAGTGGAATCCTCGAGGATTCCACTCATCAGTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145006.2-864s1c1
Sequence:CCGGCAGTCAGCTACAACTCCACATCTCGAGATGTGGAGTTGTAGCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-483s1c1
Sequence:CCGGGCTGAAAGATGAGGACTTGGACTCGAGTCCAAGTCCTCATCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-531s1c1
Sequence:CCGGCAAGCACTTCAACAAACCCGTCTCGAGACGGGTTTGTTGAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-316s1c1
Sequence:CCGGGTGCCACCACACGAGACCTTTCTCGAGAAAGGTCTCGTGTGGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145006.2-1048s1c1
Sequence:CCGGGAAACCACTACTGAGGGTAATCTCGAGATTACCCTCAGTAGTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145006
SUSD3 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145006.2-166s21c1
Sequence:CCGGCAAGTCCTTCGTGGCAATGGTCTCGAGACCATTGCCACGAAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145006.2-274s21c1
Sequence:CCGGAGCATCGCTGAGTGGTCTTCACTCGAGTGAAGACCACTCAGCGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145006.2-992s21c1
Sequence:CCGGAGTGTTCTGTTCCGGCATATCCTCGAGGATATGCCGGAACAGAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145006.2-905s21c1
Sequence:CCGGTCGAGACTGATGAGTGGAATCCTCGAGGATTCCACTCATCAGTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145006.2-864s1c1
Sequence:CCGGCAGTCAGCTACAACTCCACATCTCGAGATGTGGAGTTGTAGCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-483s1c1
Sequence:CCGGGCTGAAAGATGAGGACTTGGACTCGAGTCCAAGTCCTCATCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-531s1c1
Sequence:CCGGCAAGCACTTCAACAAACCCGTCTCGAGACGGGTTTGTTGAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145006.2-316s1c1
Sequence:CCGGGTGCCACCACACGAGACCTTTCTCGAGAAAGGTCTCGTGTGGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145006.2-1048s1c1
Sequence:CCGGGAAACCACTACTGAGGGTAATCTCGAGATTACCCTCAGTAGTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025491
SUSD3 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025491.3-926s21c1
Sequence:CCGGGGGAGCCTAGCTGACATTAAACTCGAGTTTAATGTCAGCTAGGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-500s21c1
Sequence:CCGGACGGTACAAGCTGCCTACTTGCTCGAGCAAGTAGGCAGCTTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-678s21c1
Sequence:CCGGTGACCCACAGTGTGGACAAAGCTCGAGCTTTGTCCACACTGTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-319s21c1
Sequence:CCGGGCATGAGACCTTCGGCTTTAACTCGAGTTAAAGCCGAAGGTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-765s21c1
Sequence:CCGGTGATGGTCCACGCGTTGAACTCTCGAGAGTTCAACGCGTGGACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025491
SUSD3 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025491.3-926s21c1
Sequence:CCGGGGGAGCCTAGCTGACATTAAACTCGAGTTTAATGTCAGCTAGGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-500s21c1
Sequence:CCGGACGGTACAAGCTGCCTACTTGCTCGAGCAAGTAGGCAGCTTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-678s21c1
Sequence:CCGGTGACCCACAGTGTGGACAAAGCTCGAGCTTTGTCCACACTGTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-319s21c1
Sequence:CCGGGCATGAGACCTTCGGCTTTAACTCGAGTTAAAGCCGAAGGTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-765s21c1
Sequence:CCGGTGATGGTCCACGCGTTGAACTCTCGAGAGTTCAACGCGTGGACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025491
SUSD3 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025491.3-926s21c1
Sequence:CCGGGGGAGCCTAGCTGACATTAAACTCGAGTTTAATGTCAGCTAGGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-500s21c1
Sequence:CCGGACGGTACAAGCTGCCTACTTGCTCGAGCAAGTAGGCAGCTTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-678s21c1
Sequence:CCGGTGACCCACAGTGTGGACAAAGCTCGAGCTTTGTCCACACTGTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-319s21c1
Sequence:CCGGGCATGAGACCTTCGGCTTTAACTCGAGTTAAAGCCGAAGGTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025491.3-765s21c1
Sequence:CCGGTGATGGTCCACGCGTTGAACTCTCGAGAGTTCAACGCGTGGACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks