EMAIL THIS PAGE TO A FRIEND

SUSD4

sushi domain containing 4

Synonyms: PRO222
UniProtKB ID: Q5VX71, D3DTB9, Q6UX62, Q9BSR0, Q9NWG0
Gene ID:
Mouse(96935) sushi domain containing 4
Rat(289335) sushi domain containing 4
domestic guinea pig(100735763) sushi domain containing 4
naked mole-rat(101705016) sushi domain containing 4
cow(508637) sushi domain containing 4
sheep(101108067) sushi domain containing 4
chicken(770442) sushi domain containing 4
domestic cat(101082457) sushi domain containing 4
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017982 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037175 Rosetta Predictions human pricing
NM_017982 Rosetta Predictions human pricing
NM_001105982 Rosetta Predictions rat pricing
NM_144796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308234 predicted 500
2 SASI_Hs01_00073401 predicted 537
3 SASI_Hs01_00073402 predicted 512
4 SASI_Hs01_00073403 predicted 556
5 SASI_Hs01_00073404 predicted 590
6 SASI_Hs01_00073405 predicted 538
7 SASI_Hs01_00073406 predicted 676
8 SASI_Hs01_00073407 predicted 650
9 SASI_Hs01_00073408 predicted 457
10 SASI_Hs01_00073409 predicted 644
11 SASI_Hs01_00073410 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351021 predicted 503
2 SASI_Hs01_00142581 predicted 541
3 SASI_Hs01_00142582 predicted 513
4 SASI_Hs01_00142583 predicted 558
5 SASI_Hs01_00142584 predicted 591
6 SASI_Hs01_00142585 predicted 545
7 SASI_Hs01_00142586 predicted 674
8 SASI_Hs01_00142587 predicted 648
9 SASI_Hs01_00142588 predicted 455
10 SASI_Hs01_00142589 predicted 640
11 SASI_Hs01_00142590 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214462 predicted 1124
2 SASI_Rn02_00214463 predicted 599
3 SASI_Rn02_00214464 predicted 722
4 SASI_Rn02_00214465 predicted 806
5 SASI_Rn02_00214466 predicted 1067
6 SASI_Rn02_00214467 predicted 824
7 SASI_Rn02_00214468 predicted 1189
8 SASI_Rn02_00214469 predicted 505
9 SASI_Rn02_00214470 predicted 1458
10 SASI_Rn02_00214471 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090847 predicted 544
2 SASI_Mm01_00090849 predicted 686
3 SASI_Mm01_00090850 predicted 1022
4 SASI_Mm01_00090851 predicted 394
5 SASI_Mm01_00090852 predicted 879
6 SASI_Mm01_00090853 predicted 1259
7 SASI_Mm01_00090854 predicted 516
8 SASI_Mm02_00340138 predicted 212
9 SASI_Mm01_00090855 predicted 1423
10 SASI_Mm02_00340139 predicted 1225
11 SASI_Mm01_00090846 predicted 937
12 SASI_Mm01_00090848 predicted 1159
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017982
SUSD4 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-533s1c1
Sequence:CCGGCCTACACAATATGGTTTCATTCTCGAGAATGAAACCATATTGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-1468s1c1
Sequence:CCGGGCAGTGAGAAAGGAAAGGAAACTCGAGTTTCCTTTCCTTTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-560s1c1
Sequence:CCGGCGATGATGGAACGTGGAATAACTCGAGTTATTCCACGTTCCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-571s1c1
Sequence:CCGGCGTGGAATAATCTGCCCATCTCTCGAGAGATGGGCAGATTATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-410s21c1
Sequence:CCGGGAAGGCTCTGTAGCCCGATTTCTCGAGAAATCGGGCTACAGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-1074s21c1
Sequence:CCGGATCAAGTCTACTGCATCAAATCTCGAGATTTGATGCAGTAGACTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-562s21c1
Sequence:CCGGCGAAGATGCTGAGATTCATAACTCGAGTTATGAATCTCAGCATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-923s21c1
Sequence:CCGGATGGTGAGTCACGGAGATTTCCTCGAGGAAATCTCCGTGACTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017982
SUSD4 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-533s1c1
Sequence:CCGGCCTACACAATATGGTTTCATTCTCGAGAATGAAACCATATTGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-1468s1c1
Sequence:CCGGGCAGTGAGAAAGGAAAGGAAACTCGAGTTTCCTTTCCTTTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-560s1c1
Sequence:CCGGCGATGATGGAACGTGGAATAACTCGAGTTATTCCACGTTCCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-571s1c1
Sequence:CCGGCGTGGAATAATCTGCCCATCTCTCGAGAGATGGGCAGATTATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-410s21c1
Sequence:CCGGGAAGGCTCTGTAGCCCGATTTCTCGAGAAATCGGGCTACAGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-1074s21c1
Sequence:CCGGATCAAGTCTACTGCATCAAATCTCGAGATTTGATGCAGTAGACTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-562s21c1
Sequence:CCGGCGAAGATGCTGAGATTCATAACTCGAGTTATGAATCTCAGCATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-923s21c1
Sequence:CCGGATGGTGAGTCACGGAGATTTCCTCGAGGAAATCTCCGTGACTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017982
SUSD4 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-533s1c1
Sequence:CCGGCCTACACAATATGGTTTCATTCTCGAGAATGAAACCATATTGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-1468s1c1
Sequence:CCGGGCAGTGAGAAAGGAAAGGAAACTCGAGTTTCCTTTCCTTTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-560s1c1
Sequence:CCGGCGATGATGGAACGTGGAATAACTCGAGTTATTCCACGTTCCATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017982.1-571s1c1
Sequence:CCGGCGTGGAATAATCTGCCCATCTCTCGAGAGATGGGCAGATTATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-410s21c1
Sequence:CCGGGAAGGCTCTGTAGCCCGATTTCTCGAGAAATCGGGCTACAGAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-1074s21c1
Sequence:CCGGATCAAGTCTACTGCATCAAATCTCGAGATTTGATGCAGTAGACTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-562s21c1
Sequence:CCGGCGAAGATGCTGAGATTCATAACTCGAGTTATGAATCTCAGCATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017982.3-923s21c1
Sequence:CCGGATGGTGAGTCACGGAGATTTCCTCGAGGAAATCTCCGTGACTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144796
SUSD4 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144796.2-373s1c1
Sequence:CCGGGTAACCCGATTTCACTGCCAACTCGAGTTGGCAGTGAAATCGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144796.4-1717s21c1
Sequence:CCGGCATAAGGACAGTGATTCATACCTCGAGGTATGAATCACTGTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-876s21c1
Sequence:CCGGTATGGTAAGTCACGGAGATTTCTCGAGAAATCTCCGTGACTTACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144796.4-802s1c1
Sequence:CCGGGAGTGCTTACACAACCTTATCCTCGAGGATAAGGTTGTGTAAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-551s21c1
Sequence:CCGGACGGAGAGAAGTTAGTCATTGCTCGAGCAATGACTAACTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-608s21c1
Sequence:CCGGTGTACAACCTGGTTTCGTTATCTCGAGATAACGAAACCAGGTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-759s21c1
Sequence:CCGGTCGCTGCTTCCCTGGATTTAACTCGAGTTAAATCCAGGGAAGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144796
SUSD4 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144796.2-373s1c1
Sequence:CCGGGTAACCCGATTTCACTGCCAACTCGAGTTGGCAGTGAAATCGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144796.4-1717s21c1
Sequence:CCGGCATAAGGACAGTGATTCATACCTCGAGGTATGAATCACTGTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-876s21c1
Sequence:CCGGTATGGTAAGTCACGGAGATTTCTCGAGAAATCTCCGTGACTTACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144796.4-802s1c1
Sequence:CCGGGAGTGCTTACACAACCTTATCCTCGAGGATAAGGTTGTGTAAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-551s21c1
Sequence:CCGGACGGAGAGAAGTTAGTCATTGCTCGAGCAATGACTAACTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-608s21c1
Sequence:CCGGTGTACAACCTGGTTTCGTTATCTCGAGATAACGAAACCAGGTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-759s21c1
Sequence:CCGGTCGCTGCTTCCCTGGATTTAACTCGAGTTAAATCCAGGGAAGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144796
SUSD4 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144796.2-373s1c1
Sequence:CCGGGTAACCCGATTTCACTGCCAACTCGAGTTGGCAGTGAAATCGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144796.4-1717s21c1
Sequence:CCGGCATAAGGACAGTGATTCATACCTCGAGGTATGAATCACTGTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-876s21c1
Sequence:CCGGTATGGTAAGTCACGGAGATTTCTCGAGAAATCTCCGTGACTTACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144796.4-802s1c1
Sequence:CCGGGAGTGCTTACACAACCTTATCCTCGAGGATAAGGTTGTGTAAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-551s21c1
Sequence:CCGGACGGAGAGAAGTTAGTCATTGCTCGAGCAATGACTAACTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-608s21c1
Sequence:CCGGTGTACAACCTGGTTTCGTTATCTCGAGATAACGAAACCAGGTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144796.4-759s21c1
Sequence:CCGGTCGCTGCTTCCCTGGATTTAACTCGAGTTAAATCCAGGGAAGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks