EMAIL THIS PAGE TO A FRIEND

SUSD5

sushi domain containing 5

UniProtKB ID: O60279
Gene ID:
Mouse(382111) sushi domain containing 5
Rat(301039) sushi domain containing 5
Zebrafish(101886789) sushi domain containing 5
chicken(776464) sushi domain containing 5
domestic cat(101097270) sushi domain containing 5
Horse(100056205) sushi domain containing 5
dog(485576) sushi domain containing 5
cow(524663) sushi domain containing 5
sheep(101113440) sushi domain containing 5
naked mole-rat(101710009) sushi domain containing 5
domestic guinea pig(100720538) sushi domain containing 5
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015551 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121741 MISSION® esiRNA esiRNA human SUSD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015551 Rosetta Predictions human pricing
XM_171054 Rosetta Predictions human pricing
XM_001076682 Rosetta Predictions rat pricing
XM_236674 Rosetta Predictions rat pricing
NM_001101510 Rosetta Predictions mouse pricing
XM_356198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348081 predicted 797
2 SASI_Hs02_00348082 predicted 892
3 SASI_Hs02_00348083 predicted 1640
4 SASI_Hs02_00348084 predicted 1037
5 SASI_Hs02_00348085 predicted 1896
6 SASI_Hs02_00348086 predicted 1799
7 SASI_Hs02_00348087 predicted 2016
8 SASI_Hs02_00348088 predicted 1913
9 SASI_Hs02_00348089 predicted 2364
10 SASI_Hs02_00348090 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_171054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274046 predicted 970
2 SASI_Hs01_00274047 predicted 1600
3 SASI_Hs01_00274048 predicted 1071
4 SASI_Hs01_00274049 predicted 1815
5 SASI_Hs01_00274050 predicted 1224
6 SASI_Hs01_00274051 predicted 2081
7 SASI_Hs01_00274052 predicted 2194
8 SASI_Hs01_00274053 predicted 2088
9 SASI_Hs01_00274054 predicted 1997
10 SASI_Hs01_00274055 predicted 2544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354140 predicted 534
2 SASI_Rn02_00354141 predicted 1414
3 SASI_Rn02_00354142 predicted 1195
4 SASI_Rn02_00354143 predicted 1572
5 SASI_Rn02_00354144 predicted 849
6 SASI_Rn02_00354145 predicted 1570
7 SASI_Rn02_00354146 predicted 523
8 SASI_Rn02_00354147 predicted 1464
9 SASI_Rn02_00354148 predicted 1440
10 SASI_Rn02_00354149 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390319 predicted 1576
2 SASI_Rn02_00390320 predicted 295
3 SASI_Rn02_00390321 predicted 1681
4 SASI_Rn02_00390322 predicted 1567
5 SASI_Rn02_00390323 predicted 315
6 SASI_Rn02_00390324 predicted 1582
7 SASI_Rn02_00390325 predicted 1678
8 SASI_Rn02_00390326 predicted 265
9 SASI_Rn02_00390327 predicted 300
10 SASI_Rn02_00390328 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302547 predicted 1539
2 SASI_Mm02_00302548 predicted 562
3 SASI_Mm02_00302549 predicted 930
4 SASI_Mm02_00302550 predicted 1090
5 SASI_Mm02_00302551 predicted 2088
6 SASI_Mm02_00302552 predicted 1171
7 SASI_Mm02_00302553 predicted 822
8 SASI_Mm02_00302554 predicted 1551
9 SASI_Mm02_00302555 predicted 2136
10 SASI_Mm02_00302556 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232272 predicted 2378
2 SASI_Mm01_00232273 predicted 2745
3 SASI_Mm01_00232274 predicted 2636
4 SASI_Mm01_00232275 predicted 2662
5 SASI_Mm01_00232276 predicted 2431
6 SASI_Mm01_00232277 predicted 2731
7 SASI_Mm01_00232278 predicted 2612
8 SASI_Mm01_00232279 predicted 2746
9 SASI_Mm01_00232280 predicted 2465
10 SASI_Mm01_00232281 predicted 2439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101510
SUSD5 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1460s21c1
Sequence:CCGGCTCGATCAGTCCATCTCAAATCTCGAGATTTGAGATGGACTGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1435s21c1
Sequence:CCGGCACCTAGTGAATCCGTGATACCTCGAGGTATCACGGATTCACTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1538s21c1
Sequence:CCGGCCATACCAGGGATGTTGATTCCTCGAGGAATCAACATCCCTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1665s21c1
Sequence:CCGGACCCTCCAGCCGACACATAAACTCGAGTTTATGTGTCGGCTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101510.1-3540s21c1
Sequence:CCGGACGTAAGTAGATGGTATTAATCTCGAGATTAATACCATCTACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101510
SUSD5 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1460s21c1
Sequence:CCGGCTCGATCAGTCCATCTCAAATCTCGAGATTTGAGATGGACTGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1435s21c1
Sequence:CCGGCACCTAGTGAATCCGTGATACCTCGAGGTATCACGGATTCACTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1538s21c1
Sequence:CCGGCCATACCAGGGATGTTGATTCCTCGAGGAATCAACATCCCTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1665s21c1
Sequence:CCGGACCCTCCAGCCGACACATAAACTCGAGTTTATGTGTCGGCTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101510.1-3540s21c1
Sequence:CCGGACGTAAGTAGATGGTATTAATCTCGAGATTAATACCATCTACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101510
SUSD5 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1460s21c1
Sequence:CCGGCTCGATCAGTCCATCTCAAATCTCGAGATTTGAGATGGACTGATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1435s21c1
Sequence:CCGGCACCTAGTGAATCCGTGATACCTCGAGGTATCACGGATTCACTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1538s21c1
Sequence:CCGGCCATACCAGGGATGTTGATTCCTCGAGGAATCAACATCCCTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101510.1-1665s21c1
Sequence:CCGGACCCTCCAGCCGACACATAAACTCGAGTTTATGTGTCGGCTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101510.1-3540s21c1
Sequence:CCGGACGTAAGTAGATGGTATTAATCTCGAGATTAATACCATCTACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015551
VALIDATED
SUSD5 MISSION shRNA Bacterial Glycerol Stock
sushi domain containing 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-4645s21c1
Sequence:CCGGTACCAACAAATAGGCAATATTCTCGAGAATATTGCCTATTTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-1381s21c1
Sequence:CCGGAGACAACCACAGTGGTGTAAACTCGAGTTTACACCACTGTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-1023s21c1
Sequence:CCGGCTGAGGCACACATTGACTATGCTCGAGCATAGTCAATGTGTGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015551.1-1892s21c1
Sequence:CCGGAGCTCCACCCTGGAGATATTACTCGAGTAATATCTCCAGGGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015551
VALIDATED
SUSD5 MISSION shRNA shRNA Plasmid DNA
sushi domain containing 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-4645s21c1
Sequence:CCGGTACCAACAAATAGGCAATATTCTCGAGAATATTGCCTATTTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-1381s21c1
Sequence:CCGGAGACAACCACAGTGGTGTAAACTCGAGTTTACACCACTGTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-1023s21c1
Sequence:CCGGCTGAGGCACACATTGACTATGCTCGAGCATAGTCAATGTGTGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015551.1-1892s21c1
Sequence:CCGGAGCTCCACCCTGGAGATATTACTCGAGTAATATCTCCAGGGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015551
VALIDATED
SUSD5 MISSION shRNA Lentiviral Transduction Particles
sushi domain containing 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-4645s21c1
Sequence:CCGGTACCAACAAATAGGCAATATTCTCGAGAATATTGCCTATTTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-1381s21c1
Sequence:CCGGAGACAACCACAGTGGTGTAAACTCGAGTTTACACCACTGTGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015551.1-1023s21c1
Sequence:CCGGCTGAGGCACACATTGACTATGCTCGAGCATAGTCAATGTGTGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015551.1-1892s21c1
Sequence:CCGGAGCTCCACCCTGGAGATATTACTCGAGTAATATCTCCAGGGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks