EMAIL THIS PAGE TO A FRIEND

SUV39H1

suppressor of variegation 3-9 homolog 1 (Drosophila)

Synonyms: H3-K9-HMTase 1 KMT1A MG44 SUV39H
UniProtKB ID: O43463, B2R6E8, Q53G60, Q6FHK6
Gene ID:
Human(6839) Summary: This gene is a member of the suppressor of variegation 3-9 homolog family and encodes a protein with a chromodomain and a C-terminal SET domain. This nuclear protein moves to the centromeres during mitosis and functions as a histone methyltransferase, methylating Lys-9 of histone H3. Overall, it plays a vital role in heterochromatin organization, chromosome segregation, and mitotic progression. [provided by RefSeq, Jul 2008]
Mouse(20937) suppressor of variegation 3-9 homolog 1 (Drosophila)
Rat(302553) suppressor of variegation 3-9 homolog 1 (Drosophila)
chicken(100857640) suppressor of variegation 3-9 homolog 1 (Drosophila)
domestic cat(101083571) suppressor of variegation 3-9 homolog 1 (Drosophila)
dog(491868) suppressor of variegation 3-9 homolog 1 (Drosophila)
cow(523047) suppressor of variegation 3-9 homolog 1 (Drosophila)
sheep(101110031) suppressor of variegation 3-9 homolog 1 (Drosophila)
domestic guinea pig(100731248) suppressor of variegation 3-9 homolog 1 (Drosophila)
naked mole-rat(101706867) suppressor of variegation 3-9 homolog 1 (Drosophila)
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108230 Anti-SUV39H1 antibody produced in rabbit affinity isolated antibody human, bovine, guinea pig, canine, rat, rabbit, mouse, horse
western blot pricing
AV32470 Anti-SUV39H1 antibody produced in rabbit IgG fraction of antiserum zebrafish, mouse, rabbit, rat, bovine, canine, human, guinea pig,
western blot pricing
SAB2102342 Anti-SUV39H1 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, rat, rabbit, human, horse, bovine, mouse
western blot pricing
SAB1300002 Monoclonal Anti-SUV39H1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
S8316 Monoclonal Anti-SUV39H1 Histone Methyltransferase antibody produced in mouse ~2 mg/mL, clone 44.1, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003173 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003173 Rosetta Predictions human pricing
NM_001106956 Rosetta Predictions rat pricing
NM_011514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335192 predicted 1028
2 SASI_Hs01_00040727 predicted 740
3 SASI_Hs01_00040728 predicted 752
4 SASI_Hs01_00040729 predicted 1217
5 SASI_Hs01_00040730 predicted 829
6 SASI_Hs01_00040731 predicted 1224
7 SASI_Hs02_00335193 predicted 1003
8 SASI_Hs01_00040733 predicted 511
9 SASI_Hs01_00040734 predicted 857
10 SASI_Hs01_00040735 predicted 467
11 SASI_Hs01_00040732 predicted 1518
12 SASI_Hs01_00040736 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224066 predicted 1170
2 SASI_Rn02_00224067 predicted 1406
3 SASI_Rn02_00224068 predicted 1264
4 SASI_Rn02_00224069 predicted 633
5 SASI_Rn02_00224070 predicted 614
6 SASI_Rn02_00224071 predicted 1622
7 SASI_Rn02_00224072 predicted 491
8 SASI_Rn02_00224073 predicted 1381
9 SASI_Rn02_00224074 predicted 1137
10 SASI_Rn02_00224075 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176339 predicted 836
2 SASI_Mm01_00176340 predicted 1548
3 SASI_Mm01_00176341 predicted 1104
4 SASI_Mm01_00176342 predicted 831
5 SASI_Mm01_00176344 predicted 493
6 SASI_Mm01_00176345 predicted 1538
7 SASI_Mm01_00176346 predicted 1105
8 SASI_Mm01_00176347 predicted 1196
9 SASI_Mm01_00176348 predicted 705
10 SASI_Mm02_00320832 predicted 756
11 SASI_Mm01_00176343 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011514
VALIDATED
SUV39H1 MISSION shRNA Bacterial Glycerol Stock
suppressor of variegation 3-9 homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-1154s21c1
Sequence:CCGGCCCGAATGGACTCCAACTTTGCTCGAGCAAAGTTGGAGTCCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011514.1-1874s21c1
Sequence:CCGGGCCTTTGTACTCAGGAAAGAACTCGAGTTCTTTCCTGAGTACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-621s21c1
Sequence:CCGGCCTGCACAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-184s21c1
Sequence:CCGGATCCGTGAGCAGGAGTATTACCTCGAGGTAATACTCCTGCTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-1874s1c1
Sequence:CCGGGCCTTTGTACTCAGGAAAGAACTCGAGTTCTTTCCTGAGTACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-1207s1c1
Sequence:CCGGCGAGTCCGTATTGAATGCAAACTCGAGTTTGCATTCAATACGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-621s1c1
Sequence:CCGGCCTGCACAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-757s1c1
Sequence:CCGGCTCTGCATCTTCCGCACTAATCTCGAGATTAGTGCGGAAGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011514.1-54s1c1
Sequence:CCGGGTGCTGTAAATCTTCTTGGAACTCGAGTTCCAAGAAGATTTACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011514
VALIDATED
SUV39H1 MISSION shRNA shRNA Plasmid DNA
suppressor of variegation 3-9 homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-1154s21c1
Sequence:CCGGCCCGAATGGACTCCAACTTTGCTCGAGCAAAGTTGGAGTCCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011514.1-1874s21c1
Sequence:CCGGGCCTTTGTACTCAGGAAAGAACTCGAGTTCTTTCCTGAGTACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-621s21c1
Sequence:CCGGCCTGCACAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-184s21c1
Sequence:CCGGATCCGTGAGCAGGAGTATTACCTCGAGGTAATACTCCTGCTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-1874s1c1
Sequence:CCGGGCCTTTGTACTCAGGAAAGAACTCGAGTTCTTTCCTGAGTACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-1207s1c1
Sequence:CCGGCGAGTCCGTATTGAATGCAAACTCGAGTTTGCATTCAATACGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-621s1c1
Sequence:CCGGCCTGCACAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-757s1c1
Sequence:CCGGCTCTGCATCTTCCGCACTAATCTCGAGATTAGTGCGGAAGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011514.1-54s1c1
Sequence:CCGGGTGCTGTAAATCTTCTTGGAACTCGAGTTCCAAGAAGATTTACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011514
VALIDATED
SUV39H1 MISSION shRNA Lentiviral Transduction Particles
suppressor of variegation 3-9 homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-1154s21c1
Sequence:CCGGCCCGAATGGACTCCAACTTTGCTCGAGCAAAGTTGGAGTCCATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011514.1-1874s21c1
Sequence:CCGGGCCTTTGTACTCAGGAAAGAACTCGAGTTCTTTCCTGAGTACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-621s21c1
Sequence:CCGGCCTGCACAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011514.1-184s21c1
Sequence:CCGGATCCGTGAGCAGGAGTATTACCTCGAGGTAATACTCCTGCTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-1874s1c1
Sequence:CCGGGCCTTTGTACTCAGGAAAGAACTCGAGTTCTTTCCTGAGTACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-1207s1c1
Sequence:CCGGCGAGTCCGTATTGAATGCAAACTCGAGTTTGCATTCAATACGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-621s1c1
Sequence:CCGGCCTGCACAAGTTTGCCTACAACTCGAGTTGTAGGCAAACTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011514.1-757s1c1
Sequence:CCGGCTCTGCATCTTCCGCACTAATCTCGAGATTAGTGCGGAAGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011514.1-54s1c1
Sequence:CCGGGTGCTGTAAATCTTCTTGGAACTCGAGTTCCAAGAAGATTTACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003173
VALIDATED
SUV39H1 MISSION shRNA Bacterial Glycerol Stock
suppressor of variegation 3-9 homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-177s21c1
Sequence:CCGGAGTCGAGTACCTGTGCGATTACTCGAGTAATCGCACAGGTACTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-861s21c1
Sequence:CCGGGTACGTGGGAGAGATCATTACCTCGAGGTAATGATCTCTCCCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-204s21c1
Sequence:CCGGGATCCGCGAACAGGAATATTACTCGAGTAATATTCCTGTTCGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003173.2-1254s21c1
Sequence:CCGGGACTGAGTCCTGCCGCAAATACTCGAGTATTTGCGGCAGGACTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-1554s21c1
Sequence:CCGGCGTTGGGATTCATGGCCTATTCTCGAGAATAGGCCATGAATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003173.1-1001s1c1
Sequence:CCGGCCCACTTTGTCAACCACAGTTCTCGAGAACTGTGGTTGACAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003173.1-1035s1c1
Sequence:CCGGGCAGGTGTACAACGTCTTCATCTCGAGATGAAGACGTTGTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003173.1-1082s1c1
Sequence:CCGGGCATCGCTTTCTTTGCCACAACTCGAGTTGTGGCAAAGAAAGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003173.1-186s1c1
Sequence:CCGGCCTGTGCGATTACAAGAAGATCTCGAGATCTTCTTGTAATCGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003173.1-2141s1c1
Sequence:CCGGGATAGCACTTAGGACAAGAATCTCGAGATTCTTGTCCTAAGTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003173
VALIDATED
SUV39H1 MISSION shRNA shRNA Plasmid DNA
suppressor of variegation 3-9 homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-177s21c1
Sequence:CCGGAGTCGAGTACCTGTGCGATTACTCGAGTAATCGCACAGGTACTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-861s21c1
Sequence:CCGGGTACGTGGGAGAGATCATTACCTCGAGGTAATGATCTCTCCCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-204s21c1
Sequence:CCGGGATCCGCGAACAGGAATATTACTCGAGTAATATTCCTGTTCGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003173.2-1254s21c1
Sequence:CCGGGACTGAGTCCTGCCGCAAATACTCGAGTATTTGCGGCAGGACTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-1554s21c1
Sequence:CCGGCGTTGGGATTCATGGCCTATTCTCGAGAATAGGCCATGAATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003173.1-1001s1c1
Sequence:CCGGCCCACTTTGTCAACCACAGTTCTCGAGAACTGTGGTTGACAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003173.1-1035s1c1
Sequence:CCGGGCAGGTGTACAACGTCTTCATCTCGAGATGAAGACGTTGTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003173.1-1082s1c1
Sequence:CCGGGCATCGCTTTCTTTGCCACAACTCGAGTTGTGGCAAAGAAAGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003173.1-186s1c1
Sequence:CCGGCCTGTGCGATTACAAGAAGATCTCGAGATCTTCTTGTAATCGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003173.1-2141s1c1
Sequence:CCGGGATAGCACTTAGGACAAGAATCTCGAGATTCTTGTCCTAAGTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003173
VALIDATED
SUV39H1 MISSION shRNA Lentiviral Transduction Particles
suppressor of variegation 3-9 homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-177s21c1
Sequence:CCGGAGTCGAGTACCTGTGCGATTACTCGAGTAATCGCACAGGTACTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-861s21c1
Sequence:CCGGGTACGTGGGAGAGATCATTACCTCGAGGTAATGATCTCTCCCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-204s21c1
Sequence:CCGGGATCCGCGAACAGGAATATTACTCGAGTAATATTCCTGTTCGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003173.2-1254s21c1
Sequence:CCGGGACTGAGTCCTGCCGCAAATACTCGAGTATTTGCGGCAGGACTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003173.2-1554s21c1
Sequence:CCGGCGTTGGGATTCATGGCCTATTCTCGAGAATAGGCCATGAATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003173.1-1001s1c1
Sequence:CCGGCCCACTTTGTCAACCACAGTTCTCGAGAACTGTGGTTGACAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003173.1-1035s1c1
Sequence:CCGGGCAGGTGTACAACGTCTTCATCTCGAGATGAAGACGTTGTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003173.1-1082s1c1
Sequence:CCGGGCATCGCTTTCTTTGCCACAACTCGAGTTGTGGCAAAGAAAGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003173.1-186s1c1
Sequence:CCGGCCTGTGCGATTACAAGAAGATCTCGAGATCTTCTTGTAATCGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003173.1-2141s1c1
Sequence:CCGGGATAGCACTTAGGACAAGAATCTCGAGATTCTTGTCCTAAGTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks