EMAIL THIS PAGE TO A FRIEND

SUV39H2

suppressor of variegation 3-9 homolog 2 (Drosophila)

Synonyms: KMT1B
UniProtKB ID: Q9H5I1, D3DRT4, Q5JSS4, Q5JSS5, Q6I9Y3, Q8ND06
Gene ID:
Mouse(64707) suppressor of variegation 3-9 homolog 2 (Drosophila)
Rat(364785) suppressor of variegation 3-9 homolog 2 (Drosophila)
chicken(426314) suppressor of variegation 3-9 homolog 2 (Drosophila)
dog(477995) suppressor of variegation 3-9 homolog 2 (Drosophila)
domestic cat(101099218) suppressor of variegation 3-9 homolog 2 (Drosophila)
naked mole-rat(101701917) suppressor of variegation 3-9 homolog 2 (Drosophila)
domestic guinea pig(100728513) suppressor of variegation 3-9 homolog 2 (Drosophila)
cow(536936) suppressor of variegation 3-9 homolog 2 (Drosophila)
sheep(101116417) suppressor of variegation 3-9 homolog 2 (Drosophila)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093651 MISSION® esiRNA esiRNA targeting human SUV39H2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024670 Rosetta Predictions human pricing
NM_001108883 Rosetta Predictions rat pricing
NM_022724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101226 predicted 610
2 SASI_Hs02_00357085 predicted 431
3 SASI_Hs01_00101228 predicted 582
4 SASI_Hs01_00101229 predicted 1291
5 SASI_Hs01_00101230 predicted 301
6 SASI_Hs01_00101231 predicted 766
7 SASI_Hs01_00101232 predicted 547
8 SASI_Hs02_00357086 predicted 1045
9 SASI_Hs01_00101234 predicted 751
10 SASI_Hs02_00357087 predicted 1366
11 SASI_Hs01_00101225 predicted 627
12 SASI_Hs01_00101227 predicted 1377
13 SASI_Hs01_00101233 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243025 predicted 646
2 SASI_Rn02_00243026 predicted 940
3 SASI_Rn02_00243027 predicted 415
4 SASI_Rn02_00243028 predicted 599
5 SASI_Rn02_00243029 predicted 615
6 SASI_Rn02_00243030 predicted 1227
7 SASI_Rn02_00243031 predicted 665
8 SASI_Rn02_00243032 predicted 375
9 SASI_Rn02_00243033 predicted 272
10 SASI_Rn02_00243034 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143544 predicted 634
2 SASI_Mm01_00143546 predicted 832
3 SASI_Mm02_00326643 predicted 585
4 SASI_Mm01_00143547 predicted 574
5 SASI_Mm01_00143549 predicted 593
6 SASI_Mm01_00143550 predicted 919
7 SASI_Mm01_00143551 predicted 543
8 SASI_Mm01_00143552 predicted 431
9 SASI_Mm01_00143553 predicted 271
10 SASI_Mm02_00326644 predicted 371
11 SASI_Mm01_00143545 predicted 408
12 SASI_Mm01_00143548 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024670
VALIDATED
SUV39H2 MISSION shRNA Bacterial Glycerol Stock
suppressor of variegation 3-9 homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024670.3-1580s1c1
Sequence:CCGGCCGTAGTGTTTGAAAGCGTTACTCGAGTAACGCTTTCAAACACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024670.3-725s1c1
Sequence:CCGGCCATCTATGAATGCAACTCAACTCGAGTTGAGTTGCATTCATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024670.3-1054s1c1
Sequence:CCGGCCAAATCTTCAGGTGTTCAATCTCGAGATTGAACACCTGAAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_024670.3-629s1c1
Sequence:CCGGGCACAGATTGCTTCTTTCAAACTCGAGTTTGAAAGAAGCAATCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_024670.3-542s1c1
Sequence:CCGGGCCCACCTTCAGACTTCTATTCTCGAGAATAGAAGTCTGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024670.3-1511s21c1
Sequence:CCGGTAATGGAAGGCAGACTATTTACTCGAGTAAATAGTCTGCCTTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024670.3-1371s21c1
Sequence:CCGGTCAAGGTTCTACCTATGTTAACTCGAGTTAACATAGGTAGAACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024670.3-330s21c1
Sequence:CCGGCTCTAATGACAAGCATAATTACTCGAGTAATTATGCTTGTCATTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024670
VALIDATED
SUV39H2 MISSION shRNA shRNA Plasmid DNA
suppressor of variegation 3-9 homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024670.3-1580s1c1
Sequence:CCGGCCGTAGTGTTTGAAAGCGTTACTCGAGTAACGCTTTCAAACACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024670.3-725s1c1
Sequence:CCGGCCATCTATGAATGCAACTCAACTCGAGTTGAGTTGCATTCATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024670.3-1054s1c1
Sequence:CCGGCCAAATCTTCAGGTGTTCAATCTCGAGATTGAACACCTGAAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_024670.3-629s1c1
Sequence:CCGGGCACAGATTGCTTCTTTCAAACTCGAGTTTGAAAGAAGCAATCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_024670.3-542s1c1
Sequence:CCGGGCCCACCTTCAGACTTCTATTCTCGAGAATAGAAGTCTGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024670.3-1511s21c1
Sequence:CCGGTAATGGAAGGCAGACTATTTACTCGAGTAAATAGTCTGCCTTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024670.3-1371s21c1
Sequence:CCGGTCAAGGTTCTACCTATGTTAACTCGAGTTAACATAGGTAGAACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024670.3-330s21c1
Sequence:CCGGCTCTAATGACAAGCATAATTACTCGAGTAATTATGCTTGTCATTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024670
VALIDATED
SUV39H2 MISSION shRNA Lentiviral Transduction Particles
suppressor of variegation 3-9 homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024670.3-1580s1c1
Sequence:CCGGCCGTAGTGTTTGAAAGCGTTACTCGAGTAACGCTTTCAAACACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024670.3-725s1c1
Sequence:CCGGCCATCTATGAATGCAACTCAACTCGAGTTGAGTTGCATTCATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024670.3-1054s1c1
Sequence:CCGGCCAAATCTTCAGGTGTTCAATCTCGAGATTGAACACCTGAAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_024670.3-629s1c1
Sequence:CCGGGCACAGATTGCTTCTTTCAAACTCGAGTTTGAAAGAAGCAATCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_024670.3-542s1c1
Sequence:CCGGGCCCACCTTCAGACTTCTATTCTCGAGAATAGAAGTCTGAAGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024670.3-1511s21c1
Sequence:CCGGTAATGGAAGGCAGACTATTTACTCGAGTAAATAGTCTGCCTTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024670.3-1371s21c1
Sequence:CCGGTCAAGGTTCTACCTATGTTAACTCGAGTTAACATAGGTAGAACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024670.3-330s21c1
Sequence:CCGGCTCTAATGACAAGCATAATTACTCGAGTAATTATGCTTGTCATTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022724
VALIDATED
SUV39H2 MISSION shRNA Bacterial Glycerol Stock
suppressor of variegation 3-9 homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-779s1c1
Sequence:CCGGCCACCTTTGGATGTTCATGTACTCGAGTACATGAACATCCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1175s1c1
Sequence:CCGGCAGCTCGATATGGAAACGTATCTCGAGATACGTTTCCATATCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1650s1c1
Sequence:CCGGCGGTAGATATTTGGTGGTTAACTCGAGTTAACCACCAAATATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1174s1c1
Sequence:CCGGGCAGCTCGATATGGAAACGTACTCGAGTACGTTTCCATATCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022724.2-589s1c1
Sequence:CCGGGCTGAGTATATTGTACAGAAACTCGAGTTTCTGTACAATATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-313s21c1
Sequence:CCGGTGATACTCTCCAGGAATTATGCTCGAGCATAATTCCTGGAGAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-860s21c1
Sequence:CCGGGGAGTTGTGTTGGCTTATAATCTCGAGATTATAAGCCAACACAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-1672s21c1
Sequence:CCGGCGGTAGATATTTGGTGGTTAACTCGAGTTAACCACCAAATATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-1196s21c1
Sequence:CCGGGCAGCTCGATATGGAAACGTACTCGAGTACGTTTCCATATCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-801s21c1
Sequence:CCGGCCACCTTTGGATGTTCATGTACTCGAGTACATGAACATCCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022724
VALIDATED
SUV39H2 MISSION shRNA shRNA Plasmid DNA
suppressor of variegation 3-9 homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-779s1c1
Sequence:CCGGCCACCTTTGGATGTTCATGTACTCGAGTACATGAACATCCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1175s1c1
Sequence:CCGGCAGCTCGATATGGAAACGTATCTCGAGATACGTTTCCATATCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1650s1c1
Sequence:CCGGCGGTAGATATTTGGTGGTTAACTCGAGTTAACCACCAAATATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1174s1c1
Sequence:CCGGGCAGCTCGATATGGAAACGTACTCGAGTACGTTTCCATATCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022724.2-589s1c1
Sequence:CCGGGCTGAGTATATTGTACAGAAACTCGAGTTTCTGTACAATATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-313s21c1
Sequence:CCGGTGATACTCTCCAGGAATTATGCTCGAGCATAATTCCTGGAGAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-860s21c1
Sequence:CCGGGGAGTTGTGTTGGCTTATAATCTCGAGATTATAAGCCAACACAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-1672s21c1
Sequence:CCGGCGGTAGATATTTGGTGGTTAACTCGAGTTAACCACCAAATATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-1196s21c1
Sequence:CCGGGCAGCTCGATATGGAAACGTACTCGAGTACGTTTCCATATCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-801s21c1
Sequence:CCGGCCACCTTTGGATGTTCATGTACTCGAGTACATGAACATCCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022724
VALIDATED
SUV39H2 MISSION shRNA Lentiviral Transduction Particles
suppressor of variegation 3-9 homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-779s1c1
Sequence:CCGGCCACCTTTGGATGTTCATGTACTCGAGTACATGAACATCCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1175s1c1
Sequence:CCGGCAGCTCGATATGGAAACGTATCTCGAGATACGTTTCCATATCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1650s1c1
Sequence:CCGGCGGTAGATATTTGGTGGTTAACTCGAGTTAACCACCAAATATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022724.2-1174s1c1
Sequence:CCGGGCAGCTCGATATGGAAACGTACTCGAGTACGTTTCCATATCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022724.2-589s1c1
Sequence:CCGGGCTGAGTATATTGTACAGAAACTCGAGTTTCTGTACAATATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-313s21c1
Sequence:CCGGTGATACTCTCCAGGAATTATGCTCGAGCATAATTCCTGGAGAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-860s21c1
Sequence:CCGGGGAGTTGTGTTGGCTTATAATCTCGAGATTATAAGCCAACACAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-1672s21c1
Sequence:CCGGCGGTAGATATTTGGTGGTTAACTCGAGTTAACCACCAAATATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-1196s21c1
Sequence:CCGGGCAGCTCGATATGGAAACGTACTCGAGTACGTTTCCATATCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022724.4-801s21c1
Sequence:CCGGCCACCTTTGGATGTTCATGTACTCGAGTACATGAACATCCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks