EMAIL THIS PAGE TO A FRIEND

SUV420H1

suppressor of variegation 4-20 homolog 1 (Drosophila)

Synonyms: CGI85 KMT5B
Gene ID:
Human(51111) Summary: This gene encodes a protein that contains a SET domain. SET domains appear to be protein-protein interaction domains that mediate interactions with a family of proteins that display similarity with dual-specificity phosphatases (dsPTPases). The function of this gene has not been determined. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(225888) suppressor of variegation 4-20 homolog 1 (Drosophila)
Rat(361688) suppressor of variegation 4-20 homolog 1 (Drosophila)
cow(767828) suppressor of variegation 4-20 homolog 1 (Drosophila)
sheep(101121812) suppressor of variegation 4-20 homolog 1 (Drosophila)
domestic guinea pig(100727663) suppressor of variegation 4-20 homolog 1 (Drosophila)
naked mole-rat(101719039) suppressor of variegation 4-20 homolog 1 (Drosophila)
Domestic Rabbit(100340037) suppressor of variegation 4-20 homolog 1 (Drosophila)
Zebrafish(572849) suppressor of variegation 4-20 homolog 1 (Drosophila)
chicken(425119) suppressor of variegation 4-20 homolog 1 (Drosophila)
domestic cat(101094702) suppressor of variegation 4-20 homolog 1 (Drosophila)
Horse(100053438) suppressor of variegation 4-20 homolog 1 (Drosophila)
dog(483690) suppressor of variegation 4-20 homolog 1 (Drosophila)
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017635 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016028 Rosetta Predictions human pricing
NM_017635 Rosetta Predictions human pricing
NM_001108512 Rosetta Predictions rat pricing
NM_144871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348728 predicted 1055
2 SASI_Hs02_00348729 predicted 1074
3 SASI_Hs02_00348730 predicted 1003
4 SASI_Hs01_00096677 predicted 1096
5 SASI_Hs02_00348731 predicted 1117
6 SASI_Hs01_00096680 predicted 1074
7 SASI_Hs02_00348732 predicted 928
8 SASI_Hs02_00348733 predicted 1120
9 SASI_Hs01_00096682 predicted 939
10 SASI_Hs02_00348734 predicted 1167
11 SASI_Hs01_00096674 predicted 1208
12 SASI_Hs01_00096675 predicted 782
13 SASI_Hs01_00096676 predicted 841
14 SASI_Hs01_00096678 predicted 466
15 SASI_Hs01_00096679 predicted 816
16 SASI_Hs01_00096681 predicted 1011
17 SASI_Hs01_00096683 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146572 predicted 1053
2 SASI_Hs01_00146573 predicted 1080
3 SASI_Hs01_00146575 predicted 1000
4 SASI_Hs01_00146576 predicted 1093
5 SASI_Hs01_00146577 predicted 1114
6 SASI_Hs01_00146578 predicted 1066
7 SASI_Hs01_00146579 predicted 921
8 SASI_Hs02_00350319 predicted 1118
9 SASI_Hs01_00146580 predicted 936
10 SASI_Hs01_00146581 predicted 1167
11 SASI_Hs01_00146574 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239379 predicted 1646
2 SASI_Rn02_00239380 predicted 1172
3 SASI_Rn02_00239381 predicted 940
4 SASI_Rn02_00239382 predicted 1107
5 SASI_Rn02_00239383 predicted 2347
6 SASI_Rn02_00239384 predicted 2216
7 SASI_Rn02_00239385 predicted 1601
8 SASI_Rn02_00239386 predicted 1276
9 SASI_Rn02_00239387 predicted 3271
10 SASI_Rn02_00239388 predicted 2945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340316 predicted 2335
2 SASI_Mm01_00077365 predicted 3432
3 SASI_Mm01_00077366 predicted 2348
4 SASI_Mm01_00077367 predicted 1534
5 SASI_Mm01_00077368 predicted 1005
6 SASI_Mm01_00077369 predicted 1516
7 SASI_Mm01_00077370 predicted 1112
8 SASI_Mm01_00077371 predicted 1548
9 SASI_Mm01_00077372 predicted 1279
10 SASI_Mm01_00077373 predicted 2217
11 SASI_Mm01_00077374 predicted 1502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017635
SUV420H1 MISSION shRNA Bacterial Glycerol Stock
suppressor of variegation 4-20 homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-515s21c1
Sequence:CCGGTTGGTTCTTGATCCCTATTTACTCGAGTAAATAGGGATCAAGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-629s21c1
Sequence:CCGGGTGAGATTTAGGCCTATTAAACTCGAGTTTAATAGGCCTAAATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-1533s21c1
Sequence:CCGGCATCTAAGCTAACTCATATAACTCGAGTTATATGAGTTAGCTTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-1050s21c1
Sequence:CCGGTGGGTCCTGCTGCGTTTATAACTCGAGTTATAAACGCAGCAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-2446s1c1
Sequence:CCGGGCAAAGACCATGACAACGATACTCGAGTATCGTTGTCATGGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017635.2-2935s1c1
Sequence:CCGGGAAAGTTTAGTGGCAGCACTTCTCGAGAAGTGCTGCCACTAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017635.2-3282s1c1
Sequence:CCGGGCTAATATCACCAGCAATGATCTCGAGATCATTGCTGGTGATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-1159s1c1
Sequence:CCGGGCGAGTGTTACACTTGCGAAACTCGAGTTTCGCAAGTGTAACACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017635.2-2772s1c1
Sequence:CCGGCGCTTGAGGTTAATAGTTGGACTCGAGTCCAACTATTAACCTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-2773s1c1
Sequence:CCGGGCTTGAGGTTAATAGTTGGAACTCGAGTTCCAACTATTAACCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-1333s1c1
Sequence:CCGGGCTCTAACACTGATGCAGATACTCGAGTATCTGCATCAGTGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017635
SUV420H1 MISSION shRNA shRNA Plasmid DNA
suppressor of variegation 4-20 homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-515s21c1
Sequence:CCGGTTGGTTCTTGATCCCTATTTACTCGAGTAAATAGGGATCAAGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-629s21c1
Sequence:CCGGGTGAGATTTAGGCCTATTAAACTCGAGTTTAATAGGCCTAAATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-1533s21c1
Sequence:CCGGCATCTAAGCTAACTCATATAACTCGAGTTATATGAGTTAGCTTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-1050s21c1
Sequence:CCGGTGGGTCCTGCTGCGTTTATAACTCGAGTTATAAACGCAGCAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-2446s1c1
Sequence:CCGGGCAAAGACCATGACAACGATACTCGAGTATCGTTGTCATGGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017635.2-2935s1c1
Sequence:CCGGGAAAGTTTAGTGGCAGCACTTCTCGAGAAGTGCTGCCACTAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017635.2-3282s1c1
Sequence:CCGGGCTAATATCACCAGCAATGATCTCGAGATCATTGCTGGTGATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-1159s1c1
Sequence:CCGGGCGAGTGTTACACTTGCGAAACTCGAGTTTCGCAAGTGTAACACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017635.2-2772s1c1
Sequence:CCGGCGCTTGAGGTTAATAGTTGGACTCGAGTCCAACTATTAACCTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-2773s1c1
Sequence:CCGGGCTTGAGGTTAATAGTTGGAACTCGAGTTCCAACTATTAACCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-1333s1c1
Sequence:CCGGGCTCTAACACTGATGCAGATACTCGAGTATCTGCATCAGTGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017635
SUV420H1 MISSION shRNA Lentiviral Transduction Particles
suppressor of variegation 4-20 homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-515s21c1
Sequence:CCGGTTGGTTCTTGATCCCTATTTACTCGAGTAAATAGGGATCAAGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-629s21c1
Sequence:CCGGGTGAGATTTAGGCCTATTAAACTCGAGTTTAATAGGCCTAAATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-1533s21c1
Sequence:CCGGCATCTAAGCTAACTCATATAACTCGAGTTATATGAGTTAGCTTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017635.3-1050s21c1
Sequence:CCGGTGGGTCCTGCTGCGTTTATAACTCGAGTTATAAACGCAGCAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-2446s1c1
Sequence:CCGGGCAAAGACCATGACAACGATACTCGAGTATCGTTGTCATGGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017635.2-2935s1c1
Sequence:CCGGGAAAGTTTAGTGGCAGCACTTCTCGAGAAGTGCTGCCACTAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017635.2-3282s1c1
Sequence:CCGGGCTAATATCACCAGCAATGATCTCGAGATCATTGCTGGTGATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-1159s1c1
Sequence:CCGGGCGAGTGTTACACTTGCGAAACTCGAGTTTCGCAAGTGTAACACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017635.2-2772s1c1
Sequence:CCGGCGCTTGAGGTTAATAGTTGGACTCGAGTCCAACTATTAACCTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-2773s1c1
Sequence:CCGGGCTTGAGGTTAATAGTTGGAACTCGAGTTCCAACTATTAACCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017635.2-1333s1c1
Sequence:CCGGGCTCTAACACTGATGCAGATACTCGAGTATCTGCATCAGTGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144871
VALIDATED
SUV420H1 MISSION shRNA Bacterial Glycerol Stock
suppressor of variegation 4-20 homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144871.3-2374s21c1
Sequence:CCGGAGTCCCTTGGATGGCTATAAACTCGAGTTTATAGCCATCCAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144871.3-1071s21c1
Sequence:CCGGCACTAGATTTCGGCCTATAAACTCGAGTTTATAGGCCGAAATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144871.3-3424s21c1
Sequence:CCGGTCTTCACCTGTAGGCATAATACTCGAGTATTATGCCTACAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144871.3-1178s21c1
Sequence:CCGGGGGAATGGGCACGGCATTATTCTCGAGAATAATGCCGTGCCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144871.3-996s21c1
Sequence:CCGGGCTCTGTGAGAACGATGACTTCTCGAGAAGTCATCGTTCTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-3165s1c1
Sequence:CCGGGCACAGATGAATCCTCATCTTCTCGAGAAGATGAGGATTCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-1724s1c1
Sequence:CCGGGCTCCTGTTATCAATAGCAAACTCGAGTTTGCTATTGATAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-2540s1c1
Sequence:CCGGCGACAAGTGAAACCTGTGAAACTCGAGTTTCACAGGTTTCACTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144871.2-997s1c1
Sequence:CCGGGCTCTGTGAGAACGATGACTTCTCGAGAAGTCATCGTTCTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144871.2-3262s1c1
Sequence:CCGGGCTGAGGCTAATTGTTGGTAACTCGAGTTACCAACAATTAGCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144871
VALIDATED
SUV420H1 MISSION shRNA shRNA Plasmid DNA
suppressor of variegation 4-20 homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144871.3-2374s21c1
Sequence:CCGGAGTCCCTTGGATGGCTATAAACTCGAGTTTATAGCCATCCAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144871.3-1071s21c1
Sequence:CCGGCACTAGATTTCGGCCTATAAACTCGAGTTTATAGGCCGAAATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144871.3-3424s21c1
Sequence:CCGGTCTTCACCTGTAGGCATAATACTCGAGTATTATGCCTACAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144871.3-1178s21c1
Sequence:CCGGGGGAATGGGCACGGCATTATTCTCGAGAATAATGCCGTGCCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144871.3-996s21c1
Sequence:CCGGGCTCTGTGAGAACGATGACTTCTCGAGAAGTCATCGTTCTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-3165s1c1
Sequence:CCGGGCACAGATGAATCCTCATCTTCTCGAGAAGATGAGGATTCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-1724s1c1
Sequence:CCGGGCTCCTGTTATCAATAGCAAACTCGAGTTTGCTATTGATAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-2540s1c1
Sequence:CCGGCGACAAGTGAAACCTGTGAAACTCGAGTTTCACAGGTTTCACTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144871.2-997s1c1
Sequence:CCGGGCTCTGTGAGAACGATGACTTCTCGAGAAGTCATCGTTCTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144871.2-3262s1c1
Sequence:CCGGGCTGAGGCTAATTGTTGGTAACTCGAGTTACCAACAATTAGCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144871
VALIDATED
SUV420H1 MISSION shRNA Lentiviral Transduction Particles
suppressor of variegation 4-20 homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144871.3-2374s21c1
Sequence:CCGGAGTCCCTTGGATGGCTATAAACTCGAGTTTATAGCCATCCAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144871.3-1071s21c1
Sequence:CCGGCACTAGATTTCGGCCTATAAACTCGAGTTTATAGGCCGAAATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144871.3-3424s21c1
Sequence:CCGGTCTTCACCTGTAGGCATAATACTCGAGTATTATGCCTACAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144871.3-1178s21c1
Sequence:CCGGGGGAATGGGCACGGCATTATTCTCGAGAATAATGCCGTGCCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144871.3-996s21c1
Sequence:CCGGGCTCTGTGAGAACGATGACTTCTCGAGAAGTCATCGTTCTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-3165s1c1
Sequence:CCGGGCACAGATGAATCCTCATCTTCTCGAGAAGATGAGGATTCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-1724s1c1
Sequence:CCGGGCTCCTGTTATCAATAGCAAACTCGAGTTTGCTATTGATAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144871.2-2540s1c1
Sequence:CCGGCGACAAGTGAAACCTGTGAAACTCGAGTTTCACAGGTTTCACTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144871.2-997s1c1
Sequence:CCGGGCTCTGTGAGAACGATGACTTCTCGAGAAGTCATCGTTCTCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144871.2-3262s1c1
Sequence:CCGGGCTGAGGCTAATTGTTGGTAACTCGAGTTACCAACAATTAGCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks