EMAIL THIS PAGE TO A FRIEND

SUV420H2

suppressor of variegation 4-20 homolog 2 (Drosophila)

Synonyms: KMT5C
UniProtKB ID: Q86Y97, Q8WZ10, Q9BRZ6
Gene ID:
Human(84787) Summary: SUV420H2 and the related enzyme SUV420H1 (MIM 610881) function as histone methyltransferases that specifically trimethylate nucleosomal histone H4 (see MIM 602822) on lysine-20 (K20) (Schotta et al., 2004 [PubMed 15145825]
Mouse(232811) suppressor of variegation 4-20 homolog 2 (Drosophila)
Rat(308345) suppressor of variegation 4-20 homolog 2 (Drosophila)
Zebrafish(569041) suppressor of variegation 4-20 homolog 2 (Drosophila)
Horse(100055743) suppressor of variegation 4-20 homolog 2 (Drosophila)
domestic cat(101091322) suppressor of variegation 4-20 homolog 2 (Drosophila)
dog(484295) suppressor of variegation 4-20 homolog 2 (Drosophila)
naked mole-rat(101707567) suppressor of variegation 4-20 homolog 2 (Drosophila)
domestic guinea pig(100713625) suppressor of variegation 4-20 homolog 2 (Drosophila)
cow(519777) suppressor of variegation 4-20 homolog 2 (Drosophila)
sheep(101121289) suppressor of variegation 4-20 homolog 2 (Drosophila)
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032701 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097791 MISSION® esiRNA esiRNA human SUV420H2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032701 Rosetta Predictions human pricing
NM_001107475 Rosetta Predictions rat pricing
NM_001115018 Rosetta Predictions mouse pricing
NM_146177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134829 predicted 1746
2 SASI_Hs01_00134830 predicted 1701
3 SASI_Hs01_00134831 predicted 1683
4 SASI_Hs01_00134832 predicted 862
5 SASI_Hs01_00134833 predicted 882
6 SASI_Hs01_00134834 predicted 460
7 SASI_Hs01_00134835 predicted 505
8 SASI_Hs01_00134836 predicted 766
9 SASI_Hs01_00134837 predicted 1745
10 SASI_Hs01_00134838 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229195 predicted 919
2 SASI_Rn02_00229196 predicted 1725
3 SASI_Rn02_00229197 predicted 1413
4 SASI_Rn02_00229198 predicted 990
5 SASI_Rn02_00229199 predicted 1842
6 SASI_Rn02_00229200 predicted 932
7 SASI_Rn02_00229201 predicted 1034
8 SASI_Rn02_00229202 predicted 1834
9 SASI_Rn02_00229203 predicted 1691
10 SASI_Rn02_00229204 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308887 predicted 710
2 SASI_Mm02_00308888 predicted 1570
3 SASI_Mm02_00308889 predicted 776
4 SASI_Mm02_00308890 predicted 727
5 SASI_Mm02_00308891 predicted 1500
6 SASI_Mm02_00308892 predicted 1550
7 SASI_Mm02_00308893 predicted 830
8 SASI_Mm02_00308894 predicted 1480
9 SASI_Mm02_00308895 predicted 786
10 SASI_Mm02_00308896 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020426 predicted 767
2 SASI_Mm01_00020427 predicted 1626
3 SASI_Mm01_00020428 predicted 830
4 SASI_Mm01_00020429 predicted 790
5 SASI_Mm01_00020430 predicted 1566
6 SASI_Mm01_00020431 predicted 1608
7 SASI_Mm01_00020432 predicted 885
8 SASI_Mm01_00020433 predicted 1534
9 SASI_Mm01_00020435 predicted 847
10 SASI_Mm02_00341877 predicted 1641
11 SASI_Mm01_00020434 predicted 1509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146177
VALIDATED
SUV420H2 MISSION shRNA Bacterial Glycerol Stock
suppressor of variegation 4-20 homolog 2 (Drosophila)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146177.1-1430s1c1
Sequence:CCGGCCACTCCTGATTTCATCCCTACTCGAGTAGGGATGAAATCAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-1516s1c1
Sequence:CCGGTCTATTGATCTGGACATCAATCTCGAGATTGATGTCCAGATCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-522s1c1
Sequence:CCGGCCGTGCTTGGAAGAAGAATGACTCGAGTCATTCTTCTTCCAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-709s1c1
Sequence:CCGGTGCAAGTTTGTGCCCTCAGATCTCGAGATCTGAGGGCACAAACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146177.1-814s1c1
Sequence:CCGGGAGAAGAATGAGCACTGTGAACTCGAGTTCACAGTGCTCATTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146177.2-882s21c1
Sequence:CCGGATGAGCACTGTGAATGCTATACTCGAGTATAGCATTCACAGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-291s21c1
Sequence:CCGGTCCGCACCCATAAGATGAATGCTCGAGCATTCATCTTATGGGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1633s21c1
Sequence:CCGGGAATGGAGTGCAGAGTCTATCCTCGAGGATAGACTCTGCACTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1562s21c1
Sequence:CCGGGTGGTCAGTCATGGTTCTATTCTCGAGAATAGAACCATGACTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1728s21c1
Sequence:CCGGAGAGCTGATCCTTGTTCTATGCTCGAGCATAGAACAAGGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-980s21c1
Sequence:CCGGTATGAGCTCCGAGAGACAAAGCTCGAGCTTTGTCTCTCGGAGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-837s21c1
Sequence:CCGGATGAAGTGACTTGCTTCTATGCTCGAGCATAGAAGCAAGTCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146177
VALIDATED
SUV420H2 MISSION shRNA shRNA Plasmid DNA
suppressor of variegation 4-20 homolog 2 (Drosophila)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146177.1-1430s1c1
Sequence:CCGGCCACTCCTGATTTCATCCCTACTCGAGTAGGGATGAAATCAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-1516s1c1
Sequence:CCGGTCTATTGATCTGGACATCAATCTCGAGATTGATGTCCAGATCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-522s1c1
Sequence:CCGGCCGTGCTTGGAAGAAGAATGACTCGAGTCATTCTTCTTCCAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-709s1c1
Sequence:CCGGTGCAAGTTTGTGCCCTCAGATCTCGAGATCTGAGGGCACAAACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146177.1-814s1c1
Sequence:CCGGGAGAAGAATGAGCACTGTGAACTCGAGTTCACAGTGCTCATTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146177.2-882s21c1
Sequence:CCGGATGAGCACTGTGAATGCTATACTCGAGTATAGCATTCACAGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-291s21c1
Sequence:CCGGTCCGCACCCATAAGATGAATGCTCGAGCATTCATCTTATGGGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1633s21c1
Sequence:CCGGGAATGGAGTGCAGAGTCTATCCTCGAGGATAGACTCTGCACTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1562s21c1
Sequence:CCGGGTGGTCAGTCATGGTTCTATTCTCGAGAATAGAACCATGACTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1728s21c1
Sequence:CCGGAGAGCTGATCCTTGTTCTATGCTCGAGCATAGAACAAGGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-980s21c1
Sequence:CCGGTATGAGCTCCGAGAGACAAAGCTCGAGCTTTGTCTCTCGGAGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-837s21c1
Sequence:CCGGATGAAGTGACTTGCTTCTATGCTCGAGCATAGAAGCAAGTCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146177
VALIDATED
SUV420H2 MISSION shRNA Lentiviral Transduction Particles
suppressor of variegation 4-20 homolog 2 (Drosophila)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146177.1-1430s1c1
Sequence:CCGGCCACTCCTGATTTCATCCCTACTCGAGTAGGGATGAAATCAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-1516s1c1
Sequence:CCGGTCTATTGATCTGGACATCAATCTCGAGATTGATGTCCAGATCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-522s1c1
Sequence:CCGGCCGTGCTTGGAAGAAGAATGACTCGAGTCATTCTTCTTCCAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146177.1-709s1c1
Sequence:CCGGTGCAAGTTTGTGCCCTCAGATCTCGAGATCTGAGGGCACAAACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146177.1-814s1c1
Sequence:CCGGGAGAAGAATGAGCACTGTGAACTCGAGTTCACAGTGCTCATTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146177.2-882s21c1
Sequence:CCGGATGAGCACTGTGAATGCTATACTCGAGTATAGCATTCACAGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-291s21c1
Sequence:CCGGTCCGCACCCATAAGATGAATGCTCGAGCATTCATCTTATGGGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1633s21c1
Sequence:CCGGGAATGGAGTGCAGAGTCTATCCTCGAGGATAGACTCTGCACTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1562s21c1
Sequence:CCGGGTGGTCAGTCATGGTTCTATTCTCGAGAATAGAACCATGACTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-1728s21c1
Sequence:CCGGAGAGCTGATCCTTGTTCTATGCTCGAGCATAGAACAAGGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-980s21c1
Sequence:CCGGTATGAGCTCCGAGAGACAAAGCTCGAGCTTTGTCTCTCGGAGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146177.2-837s21c1
Sequence:CCGGATGAAGTGACTTGCTTCTATGCTCGAGCATAGAAGCAAGTCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032701
SUV420H2 MISSION shRNA Bacterial Glycerol Stock
suppressor of variegation 4-20 homolog 2 (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-760s1c1
Sequence:CCGGCAAACCCAACTGCAAGTTTGTCTCGAGACAAACTTGCAGTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-680s1c1
Sequence:CCGGGACTTCAGCATCATGTACTCACTCGAGTGAGTACATGATGCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-688s1c1
Sequence:CCGGCATCATGTACTCAACCCGCAACTCGAGTTGCGGGTTGAGTACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-874s1c1
Sequence:CCGGCGAGAAGAATGAGCACTGTGACTCGAGTCACAGTGCTCATTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-299s1c1
Sequence:CCGGCATAAGATGAACGTCAGCCCTCTCGAGAGGGCTGACGTTCATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-294s1c1
Sequence:CCGGGCACCCATAAGATGAACGTCACTCGAGTGACGTTCATCTTATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-670s1c1
Sequence:CCGGCGGTGAGAATGACTTCAGCATCTCGAGATGCTGAAGTCATTCTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-676s1c1
Sequence:CCGGGAATGACTTCAGCATCATGTACTCGAGTACATGATGCTGAAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-618s21c1
Sequence:CCGGGTGTCCACTCGTGCTTGGAAACTCGAGTTTCCAAGCACGAGTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-961s21c1
Sequence:CCGGGTGAAGGAGCTTTCCGAACCACTCGAGTGGTTCGGAAAGCTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032701.3-1734s21c1
Sequence:CCGGTGACCCTTGACTCCAGCATAGCTCGAGCTATGCTGGAGTCAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-547s21c1
Sequence:CCGATCCTGCCGGAAAGTGGCTTTACTCGAGTAAAGCCACTTTCCGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032701
SUV420H2 MISSION shRNA shRNA Plasmid DNA
suppressor of variegation 4-20 homolog 2 (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-760s1c1
Sequence:CCGGCAAACCCAACTGCAAGTTTGTCTCGAGACAAACTTGCAGTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-680s1c1
Sequence:CCGGGACTTCAGCATCATGTACTCACTCGAGTGAGTACATGATGCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-688s1c1
Sequence:CCGGCATCATGTACTCAACCCGCAACTCGAGTTGCGGGTTGAGTACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-874s1c1
Sequence:CCGGCGAGAAGAATGAGCACTGTGACTCGAGTCACAGTGCTCATTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-299s1c1
Sequence:CCGGCATAAGATGAACGTCAGCCCTCTCGAGAGGGCTGACGTTCATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-294s1c1
Sequence:CCGGGCACCCATAAGATGAACGTCACTCGAGTGACGTTCATCTTATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-670s1c1
Sequence:CCGGCGGTGAGAATGACTTCAGCATCTCGAGATGCTGAAGTCATTCTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-676s1c1
Sequence:CCGGGAATGACTTCAGCATCATGTACTCGAGTACATGATGCTGAAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-618s21c1
Sequence:CCGGGTGTCCACTCGTGCTTGGAAACTCGAGTTTCCAAGCACGAGTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-961s21c1
Sequence:CCGGGTGAAGGAGCTTTCCGAACCACTCGAGTGGTTCGGAAAGCTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032701.3-1734s21c1
Sequence:CCGGTGACCCTTGACTCCAGCATAGCTCGAGCTATGCTGGAGTCAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-547s21c1
Sequence:CCGATCCTGCCGGAAAGTGGCTTTACTCGAGTAAAGCCACTTTCCGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032701
SUV420H2 MISSION shRNA Lentiviral Transduction Particles
suppressor of variegation 4-20 homolog 2 (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-760s1c1
Sequence:CCGGCAAACCCAACTGCAAGTTTGTCTCGAGACAAACTTGCAGTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-680s1c1
Sequence:CCGGGACTTCAGCATCATGTACTCACTCGAGTGAGTACATGATGCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-688s1c1
Sequence:CCGGCATCATGTACTCAACCCGCAACTCGAGTTGCGGGTTGAGTACATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-874s1c1
Sequence:CCGGCGAGAAGAATGAGCACTGTGACTCGAGTCACAGTGCTCATTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-299s1c1
Sequence:CCGGCATAAGATGAACGTCAGCCCTCTCGAGAGGGCTGACGTTCATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032701.2-294s1c1
Sequence:CCGGGCACCCATAAGATGAACGTCACTCGAGTGACGTTCATCTTATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-670s1c1
Sequence:CCGGCGGTGAGAATGACTTCAGCATCTCGAGATGCTGAAGTCATTCTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032701.2-676s1c1
Sequence:CCGGGAATGACTTCAGCATCATGTACTCGAGTACATGATGCTGAAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-618s21c1
Sequence:CCGGGTGTCCACTCGTGCTTGGAAACTCGAGTTTCCAAGCACGAGTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-961s21c1
Sequence:CCGGGTGAAGGAGCTTTCCGAACCACTCGAGTGGTTCGGAAAGCTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032701.3-1734s21c1
Sequence:CCGGTGACCCTTGACTCCAGCATAGCTCGAGCTATGCTGGAGTCAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032701.3-547s21c1
Sequence:CCGATCCTGCCGGAAAGTGGCTTTACTCGAGTAAAGCCACTTTCCGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks