EMAIL THIS PAGE TO A FRIEND

SUZ12

SUZ12 polycomb repressive complex 2 subunit

Synonyms: CHET9 JJAZ1
UniProtKB ID: Q15022, Q96BD9
Gene ID:
Human(23512) Summary: This zinc finger gene has been identified at the breakpoints of a recurrent chromosomal translocation reported in endometrial stromal sarcoma. Recombination of these breakpoints results in the fusion of this gene and JAZF1. The protein encoded by this gene contains a zinc finger domain in the C terminus of the coding region. [provided by RefSeq, Jul 2009]
Mouse(52615) suppressor of zeste 12 homolog (Drosophila)
chicken(417406) suppressor of zeste 12 homolog (Drosophila)
domestic cat(101093155) suppressor of zeste 12 homolog (Drosophila)
dog(491158) suppressor of zeste 12 homolog (Drosophila)
cow(538774) suppressor of zeste 12 homolog (Drosophila)
sheep(101116666) suppressor of zeste 12 homolog (Drosophila)
domestic guinea pig(100720614) SUZ12 polycomb repressive complex 2 subunit
naked mole-rat(101720893) SUZ12 polycomb repressive complex 2 subunit
194 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39190 Anti-SUZ12 (AB2) antibody produced in rabbit affinity isolated antibody horse, human, mouse, guinea pig, rabbit, bovine
western blot pricing
SAB2107890 Anti-SUZ12 antibody produced in rabbit affinity isolated antibody canine, human, guinea pig, rat, bovine, rabbit, pig, horse, mouse
ChIP, immunohistochemistry, western blot pricing
HPA057436 Anti-SUZ12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3501103 Anti-SUZ12 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB5300013 Monoclonal Anti-SUZ12 antibody produced in mouse clone 3D10, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300014 Monoclonal Anti-SUZ12 antibody produced in mouse clone 2C11, ascites fluid human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015355 Rosetta Predictions human pricing
NM_199196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347682 predicted 785
2 SASI_Hs01_00107270 predicted 2220
3 SASI_Hs01_00107271 predicted 1841
4 SASI_Hs01_00107272 predicted 1314
5 SASI_Hs01_00107274 predicted 2143
6 SASI_Hs01_00107275 predicted 1740
7 SASI_Hs01_00107276 predicted 1693
8 SASI_Hs01_00107277 predicted 2049
9 SASI_Hs01_00107279 predicted 1303
10 SASI_Hs02_00347683 predicted 1377
11 SASI_Hs01_00107273 predicted 1922
12 SASI_Hs01_00107278 predicted 2179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147934 predicted 1670
2 SASI_Mm01_00147935 predicted 1420
3 SASI_Mm01_00147936 predicted 2073
4 SASI_Mm01_00147938 predicted 1774
5 SASI_Mm02_00351380 predicted 2337
6 SASI_Mm01_00147940 predicted 2176
7 SASI_Mm01_00147941 predicted 1717
8 SASI_Mm01_00147942 predicted 1215
9 SASI_Mm02_00351381 predicted 1315
10 SASI_Mm02_00351382 predicted 822
11 SASI_Mm01_00147937 predicted 1906
12 SASI_Mm01_00147939 predicted 2463
13 SASI_Mm01_00147943 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015355
VALIDATED
SUZ12 MISSION shRNA Bacterial Glycerol Stock
SUZ12 polycomb repressive complex 2 subunit
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-529s21c1
Sequence:CCGGCGGAATCTCATAGCACCAATACTCGAGTATTGGTGCTATGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-2104s21c1
Sequence:CCGGGCTGACAATCAAATGAATCATCTCGAGATGATTCATTTGATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-696s21c1
Sequence:CCGGGCTTACGTTTACTGGTTTCTTCTCGAGAAGAAACCAGTAAACGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-1948s21c1
Sequence:CCGGCCACAAGAAATGGAAGTAGATCTCGAGATCTACTTCCATTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015355.1-501s1c1
Sequence:CCGGCGGAATCTCATAGCACCAATACTCGAGTATTGGTGCTATGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015355.1-2076s1c1
Sequence:CCGGGCTGACAATCAAATGAATCATCTCGAGATGATTCATTTGATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015355
VALIDATED
SUZ12 MISSION shRNA shRNA Plasmid DNA
SUZ12 polycomb repressive complex 2 subunit
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-529s21c1
Sequence:CCGGCGGAATCTCATAGCACCAATACTCGAGTATTGGTGCTATGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-2104s21c1
Sequence:CCGGGCTGACAATCAAATGAATCATCTCGAGATGATTCATTTGATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-696s21c1
Sequence:CCGGGCTTACGTTTACTGGTTTCTTCTCGAGAAGAAACCAGTAAACGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-1948s21c1
Sequence:CCGGCCACAAGAAATGGAAGTAGATCTCGAGATCTACTTCCATTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015355.1-501s1c1
Sequence:CCGGCGGAATCTCATAGCACCAATACTCGAGTATTGGTGCTATGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015355.1-2076s1c1
Sequence:CCGGGCTGACAATCAAATGAATCATCTCGAGATGATTCATTTGATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015355
VALIDATED
SUZ12 MISSION shRNA Lentiviral Transduction Particles
SUZ12 polycomb repressive complex 2 subunit
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-529s21c1
Sequence:CCGGCGGAATCTCATAGCACCAATACTCGAGTATTGGTGCTATGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-2104s21c1
Sequence:CCGGGCTGACAATCAAATGAATCATCTCGAGATGATTCATTTGATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-696s21c1
Sequence:CCGGGCTTACGTTTACTGGTTTCTTCTCGAGAAGAAACCAGTAAACGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015355.2-1948s21c1
Sequence:CCGGCCACAAGAAATGGAAGTAGATCTCGAGATCTACTTCCATTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015355.1-501s1c1
Sequence:CCGGCGGAATCTCATAGCACCAATACTCGAGTATTGGTGCTATGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015355.1-2076s1c1
Sequence:CCGGGCTGACAATCAAATGAATCATCTCGAGATGATTCATTTGATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199196
VALIDATED
SUZ12 MISSION shRNA Bacterial Glycerol Stock
SUZ12 polycomb repressive complex 2 subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-1896s21c1
Sequence:CCGGGTGGCCACAATCGTCTCTATTCTCGAGAATAGAGACGATTGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-1762s21c1
Sequence:CCGGTAGTCGAAATGGACCGGTAAACTCGAGTTTACCGGTCCATTTCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-2251s21c1
Sequence:CCGGTGTTACCAAGCTCCGAGAAATCTCGAGATTTCTCGGAGCTTGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-528s21c1
Sequence:GTACCGGGAAATCTTATCGCACCAATATCTCGAGATATTGGTGCGATAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-2615s21c1
Sequence:CCGGCTCACGTGCTTATCAACTTTACTCGAGTAAAGTTGATAAGCACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-2836s1c1
Sequence:CCGGGCTGTCTTAGAGATGGAGAATCTCGAGATTCTCCATCTCTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-1727s1c1
Sequence:CCGGCCTCAGGATATACATCGCCAACTCGAGTTGGCGATGTATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-576s1c1
Sequence:CCGGCTCATCGAAATTCCAGAACAACTCGAGTTGTTCTGGAATTTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-918s1c1
Sequence:CCGGCCAGTAATGAATTTGAACCTACTCGAGTAGGTTCAAATTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-2180s1c1
Sequence:CCGGCGAAACTTCATGCTTCATCTACTCGAGTAGATGAAGCATGAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199196
VALIDATED
SUZ12 MISSION shRNA shRNA Plasmid DNA
SUZ12 polycomb repressive complex 2 subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-1896s21c1
Sequence:CCGGGTGGCCACAATCGTCTCTATTCTCGAGAATAGAGACGATTGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-1762s21c1
Sequence:CCGGTAGTCGAAATGGACCGGTAAACTCGAGTTTACCGGTCCATTTCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-2251s21c1
Sequence:CCGGTGTTACCAAGCTCCGAGAAATCTCGAGATTTCTCGGAGCTTGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-528s21c1
Sequence:GTACCGGGAAATCTTATCGCACCAATATCTCGAGATATTGGTGCGATAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-2615s21c1
Sequence:CCGGCTCACGTGCTTATCAACTTTACTCGAGTAAAGTTGATAAGCACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-2836s1c1
Sequence:CCGGGCTGTCTTAGAGATGGAGAATCTCGAGATTCTCCATCTCTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-1727s1c1
Sequence:CCGGCCTCAGGATATACATCGCCAACTCGAGTTGGCGATGTATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-576s1c1
Sequence:CCGGCTCATCGAAATTCCAGAACAACTCGAGTTGTTCTGGAATTTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-918s1c1
Sequence:CCGGCCAGTAATGAATTTGAACCTACTCGAGTAGGTTCAAATTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-2180s1c1
Sequence:CCGGCGAAACTTCATGCTTCATCTACTCGAGTAGATGAAGCATGAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199196
VALIDATED
SUZ12 MISSION shRNA Lentiviral Transduction Particles
SUZ12 polycomb repressive complex 2 subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-1896s21c1
Sequence:CCGGGTGGCCACAATCGTCTCTATTCTCGAGAATAGAGACGATTGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-1762s21c1
Sequence:CCGGTAGTCGAAATGGACCGGTAAACTCGAGTTTACCGGTCCATTTCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-2251s21c1
Sequence:CCGGTGTTACCAAGCTCCGAGAAATCTCGAGATTTCTCGGAGCTTGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-528s21c1
Sequence:GTACCGGGAAATCTTATCGCACCAATATCTCGAGATATTGGTGCGATAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199196.1-2615s21c1
Sequence:CCGGCTCACGTGCTTATCAACTTTACTCGAGTAAAGTTGATAAGCACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-2836s1c1
Sequence:CCGGGCTGTCTTAGAGATGGAGAATCTCGAGATTCTCCATCTCTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-1727s1c1
Sequence:CCGGCCTCAGGATATACATCGCCAACTCGAGTTGGCGATGTATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-576s1c1
Sequence:CCGGCTCATCGAAATTCCAGAACAACTCGAGTTGTTCTGGAATTTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-918s1c1
Sequence:CCGGCCAGTAATGAATTTGAACCTACTCGAGTAGGTTCAAATTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199196.1-2180s1c1
Sequence:CCGGCGAAACTTCATGCTTCATCTACTCGAGTAGATGAAGCATGAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks