EMAIL THIS PAGE TO A FRIEND

SV2A

synaptic vesicle glycoprotein 2A

Synonyms: SV2
Gene ID:
Mouse(64051) synaptic vesicle glycoprotein 2 a
Rat(117559) synaptic vesicle glycoprotein 2a
chicken(101748163) synaptic vesicle glycoprotein 2A
domestic cat(101081564) synaptic vesicle glycoprotein 2A
dog(483176) synaptic vesicle glycoprotein 2A
chicken(101666723) synaptic vesicle glycoprotein 2A
naked mole-rat(101711194) synaptic vesicle glycoprotein 2A
domestic guinea pig(100718071) synaptic vesicle glycoprotein 2A
cow(280936) synaptic vesicle glycoprotein 2A
sheep(101123425) synaptic vesicle glycoprotein 2A
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501005 Anti-SV2A antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, rat, mouse
ELISA, western blot pricing
HPA007863 Anti-SV2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV47093 Anti-SV2A antibody produced in rabbit affinity isolated antibody guinea pig, bovine, human, mouse, horse, rat, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014849 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014849 Rosetta Predictions human pricing
NM_057210 Rosetta Predictions rat pricing
NM_022030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036836 predicted 1629
2 SASI_Hs01_00036837 predicted 2519
3 SASI_Hs02_00346414 predicted 2092
4 SASI_Hs01_00036838 predicted 1186
5 SASI_Hs01_00036839 predicted 2181
6 SASI_Hs01_00036840 predicted 2135
7 SASI_Hs01_00036841 predicted 919
8 SASI_Hs01_00036842 predicted 611
9 SASI_Hs01_00036843 predicted 1314
10 SASI_Hs01_00036844 predicted 665
11 SASI_Hs01_00036845 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058129 predicted 1537
2 SASI_Rn01_00058130 predicted 926
3 SASI_Rn01_00058131 predicted 1224
4 SASI_Rn01_00058132 predicted 483
5 SASI_Rn01_00058133 predicted 1428
6 SASI_Rn02_00267168 predicted 323
7 SASI_Rn01_00058134 predicted 810
8 SASI_Rn01_00058135 predicted 1766
9 SASI_Rn01_00058136 predicted 1486
10 SASI_Rn01_00058137 predicted 1712
11 SASI_Rn01_00058128 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085851 predicted 1802
2 SASI_Mm01_00085852 predicted 2090
3 SASI_Mm01_00085853 predicted 2063
4 SASI_Mm01_00085854 predicted 1367
5 SASI_Mm01_00085855 predicted 1857
6 SASI_Mm01_00085856 predicted 1291
7 SASI_Mm01_00085857 predicted 1124
8 SASI_Mm01_00085858 predicted 2087
9 SASI_Mm01_00085859 predicted 1896
10 SASI_Mm01_00085860 predicted 1176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014849
VALIDATED
SV2A MISSION shRNA Bacterial Glycerol Stock
synaptic vesicle glycoprotein 2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2193s1c1
Sequence:CCGGGCCGTCTGATAAACAGTACATCTCGAGATGTACTGTTTATCAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2073s1c1
Sequence:CCGGCCCTGTTTGAAGAGTGTTATTCTCGAGAATAACACTCTTCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-1660s1c1
Sequence:CCGGGTTCTCAGTAACCCACATTAACTCGAGTTAATGTGGGTTACTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2011s1c1
Sequence:CCGGCGGGCAGTACTTCAATGACAACTCGAGTTGTCATTGAAGTACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014849.2-908s1c1
Sequence:CCGGCGACGGAAAGAACGAGAAGAACTCGAGTTCTTCTCGTTCTTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-2170s21c1
Sequence:CCGGACCTGTTCGAGTACAAGTTTGCTCGAGCAAACTTGTACTCGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014849.3-912s21c1
Sequence:CCGGCGACGGAAAGAACGAGAAGAACTCGAGTTCTTCTCGTTCTTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-1311s21c1
Sequence:CCGGCCCATTGTCTTCTCCTATTTCCTCGAGGAAATAGGAGAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-595s21c1
Sequence:CCGGACAGAGTCCAGGACGAATATTCTCGAGAATATTCGTCCTGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014849.3-3092s21c1
Sequence:CCGGGAAACCACAGGTATGCAATTACTCGAGTAATTGCATACCTGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014849
VALIDATED
SV2A MISSION shRNA shRNA Plasmid DNA
synaptic vesicle glycoprotein 2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2193s1c1
Sequence:CCGGGCCGTCTGATAAACAGTACATCTCGAGATGTACTGTTTATCAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2073s1c1
Sequence:CCGGCCCTGTTTGAAGAGTGTTATTCTCGAGAATAACACTCTTCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-1660s1c1
Sequence:CCGGGTTCTCAGTAACCCACATTAACTCGAGTTAATGTGGGTTACTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2011s1c1
Sequence:CCGGCGGGCAGTACTTCAATGACAACTCGAGTTGTCATTGAAGTACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014849.2-908s1c1
Sequence:CCGGCGACGGAAAGAACGAGAAGAACTCGAGTTCTTCTCGTTCTTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-2170s21c1
Sequence:CCGGACCTGTTCGAGTACAAGTTTGCTCGAGCAAACTTGTACTCGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014849.3-912s21c1
Sequence:CCGGCGACGGAAAGAACGAGAAGAACTCGAGTTCTTCTCGTTCTTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-1311s21c1
Sequence:CCGGCCCATTGTCTTCTCCTATTTCCTCGAGGAAATAGGAGAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-595s21c1
Sequence:CCGGACAGAGTCCAGGACGAATATTCTCGAGAATATTCGTCCTGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014849.3-3092s21c1
Sequence:CCGGGAAACCACAGGTATGCAATTACTCGAGTAATTGCATACCTGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014849
VALIDATED
SV2A MISSION shRNA Lentiviral Transduction Particles
synaptic vesicle glycoprotein 2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2193s1c1
Sequence:CCGGGCCGTCTGATAAACAGTACATCTCGAGATGTACTGTTTATCAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2073s1c1
Sequence:CCGGCCCTGTTTGAAGAGTGTTATTCTCGAGAATAACACTCTTCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-1660s1c1
Sequence:CCGGGTTCTCAGTAACCCACATTAACTCGAGTTAATGTGGGTTACTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014849.2-2011s1c1
Sequence:CCGGCGGGCAGTACTTCAATGACAACTCGAGTTGTCATTGAAGTACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014849.2-908s1c1
Sequence:CCGGCGACGGAAAGAACGAGAAGAACTCGAGTTCTTCTCGTTCTTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-2170s21c1
Sequence:CCGGACCTGTTCGAGTACAAGTTTGCTCGAGCAAACTTGTACTCGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014849.3-912s21c1
Sequence:CCGGCGACGGAAAGAACGAGAAGAACTCGAGTTCTTCTCGTTCTTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-1311s21c1
Sequence:CCGGCCCATTGTCTTCTCCTATTTCCTCGAGGAAATAGGAGAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014849.3-595s21c1
Sequence:CCGGACAGAGTCCAGGACGAATATTCTCGAGAATATTCGTCCTGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014849.3-3092s21c1
Sequence:CCGGGAAACCACAGGTATGCAATTACTCGAGTAATTGCATACCTGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022030
SV2A MISSION shRNA Bacterial Glycerol Stock
synaptic vesicle glycoprotein 2A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022030.2-3173s1c1
Sequence:CCGGGCCTGGATTTAATTTATGGAACTCGAGTTCCATAAATTAAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-2089s1c1
Sequence:CCGGGTTCTATAACACTGACCTATTCTCGAGAATAGGTCAGTGTTATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-956s1c1
Sequence:CCGGGCAGATGGTGTAGAGGTCTTTCTCGAGAAAGACCTCTACACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-847s1c1
Sequence:CCGGGCGTAAAGATCGGGAAGAATTCTCGAGAATTCTTCCCGATCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-1982s1c1
Sequence:CCGGCGTCTGAAGTCAGTGTCCTTTCTCGAGAAAGGACACTGACTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022030.3-2144s21c1
Sequence:CCGGAGCACGTTCCTGCACAATAAGCTCGAGCTTATTGTGCAGGAACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022030.3-3009s21c1
Sequence:CCGGACCACAGGTATGGAGTTATAACTCGAGTTATAACTCCATACCTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022030
SV2A MISSION shRNA shRNA Plasmid DNA
synaptic vesicle glycoprotein 2A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022030.2-3173s1c1
Sequence:CCGGGCCTGGATTTAATTTATGGAACTCGAGTTCCATAAATTAAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-2089s1c1
Sequence:CCGGGTTCTATAACACTGACCTATTCTCGAGAATAGGTCAGTGTTATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-956s1c1
Sequence:CCGGGCAGATGGTGTAGAGGTCTTTCTCGAGAAAGACCTCTACACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-847s1c1
Sequence:CCGGGCGTAAAGATCGGGAAGAATTCTCGAGAATTCTTCCCGATCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-1982s1c1
Sequence:CCGGCGTCTGAAGTCAGTGTCCTTTCTCGAGAAAGGACACTGACTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022030.3-2144s21c1
Sequence:CCGGAGCACGTTCCTGCACAATAAGCTCGAGCTTATTGTGCAGGAACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022030.3-3009s21c1
Sequence:CCGGACCACAGGTATGGAGTTATAACTCGAGTTATAACTCCATACCTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022030
SV2A MISSION shRNA Lentiviral Transduction Particles
synaptic vesicle glycoprotein 2A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022030.2-3173s1c1
Sequence:CCGGGCCTGGATTTAATTTATGGAACTCGAGTTCCATAAATTAAATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-2089s1c1
Sequence:CCGGGTTCTATAACACTGACCTATTCTCGAGAATAGGTCAGTGTTATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-956s1c1
Sequence:CCGGGCAGATGGTGTAGAGGTCTTTCTCGAGAAAGACCTCTACACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-847s1c1
Sequence:CCGGGCGTAAAGATCGGGAAGAATTCTCGAGAATTCTTCCCGATCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022030.2-1982s1c1
Sequence:CCGGCGTCTGAAGTCAGTGTCCTTTCTCGAGAAAGGACACTGACTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022030.3-2144s21c1
Sequence:CCGGAGCACGTTCCTGCACAATAAGCTCGAGCTTATTGTGCAGGAACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022030.3-3009s21c1
Sequence:CCGGACCACAGGTATGGAGTTATAACTCGAGTTATAACTCCATACCTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks