EMAIL THIS PAGE TO A FRIEND

SV2B

synaptic vesicle glycoprotein 2B

Synonyms: HsT19680
UniProtKB ID: Q7L1I2, B4DH30, C6G489, O94840, Q6IAR8
Gene ID:
Mouse(64176) synaptic vesicle glycoprotein 2 b
Rat(117556) synaptic vesicle glycoprotein 2b
cow(527014) synaptic vesicle glycoprotein 2B
sheep(101120867) synaptic vesicle glycoprotein 2B
domestic guinea pig(100732870) synaptic vesicle glycoprotein 2B
naked mole-rat(101719148) synaptic vesicle glycoprotein 2B
chicken(427508) synaptic vesicle glycoprotein 2B
domestic cat(101093273) synaptic vesicle glycoprotein 2B
Horse(100070267) synaptic vesicle glycoprotein 2B
dog(488723) synaptic vesicle glycoprotein 2B
251 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014848 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014848 Rosetta Predictions human pricing
NM_057207 Rosetta Predictions rat pricing
NM_001109753 Rosetta Predictions mouse pricing
NM_153579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183250 predicted 1380
2 SASI_Hs01_00183251 predicted 1704
3 SASI_Hs01_00183252 predicted 1558
4 SASI_Hs01_00183253 predicted 1189
5 SASI_Hs01_00183254 predicted 1786
6 SASI_Hs01_00183255 predicted 799
7 SASI_Hs01_00183256 predicted 833
8 SASI_Hs01_00183258 predicted 441
9 SASI_Hs01_00183259 predicted 2067
10 SASI_Hs02_00346413 predicted 2463
11 SASI_Hs01_00183257 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072678 predicted 1425
2 SASI_Rn01_00072680 predicted 1819
3 SASI_Rn01_00072681 predicted 1141
4 SASI_Rn01_00072682 predicted 1753
5 SASI_Rn01_00072683 predicted 1914
6 SASI_Rn01_00072684 predicted 1020
7 SASI_Rn02_00267164 predicted 1849
8 SASI_Rn01_00072685 predicted 1600
9 SASI_Rn01_00072686 predicted 1874
10 SASI_Rn01_00072687 predicted 875
11 SASI_Rn01_00072679 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304284 predicted 2037
2 SASI_Mm02_00304285 predicted 1877
3 SASI_Mm02_00304286 predicted 1601
4 SASI_Mm02_00304287 predicted 2003
5 SASI_Mm02_00304288 predicted 1148
6 SASI_Mm02_00304289 predicted 1959
7 SASI_Mm02_00304290 predicted 1003
8 SASI_Mm02_00304291 predicted 1500
9 SASI_Mm02_00304292 predicted 733
10 SASI_Mm02_00304293 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124507 predicted 2248
2 SASI_Mm01_00124508 predicted 2078
3 SASI_Mm02_00343387 predicted 1806
4 SASI_Mm01_00124509 predicted 2203
5 SASI_Mm01_00124510 predicted 1352
6 SASI_Mm01_00124511 predicted 2168
7 SASI_Mm01_00124512 predicted 1213
8 SASI_Mm01_00124513 predicted 1708
9 SASI_Mm01_00124514 predicted 939
10 SASI_Mm01_00124515 predicted 1137
11 SASI_Mm01_00124516 predicted 2223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014848
SV2B MISSION shRNA Bacterial Glycerol Stock
synaptic vesicle glycoprotein 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014848.4-1792s21c1
Sequence:CCGGGATGAAGAATACAAGTCTAAACTCGAGTTTAGACTTGTATTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014848.4-2057s21c1
Sequence:CCGGAGTTCATCAACTGTCGGTTTACTCGAGTAAACCGACAGTTGATGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1839s1c1
Sequence:CCGGCGCCACAATCAACTTCACGATCTCGAGATCGTGAAGTTGATTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1519s1c1
Sequence:CCGGCCAGAGAAAGTGTTCACGGTTCTCGAGAACCGTGAACACTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-2121s1c1
Sequence:CCGGGCAAGATAATGACTTCCTGATCTCGAGATCAGGAAGTCATTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-2405s1c1
Sequence:CCGGCCTTCGGCATTCTCAATGGATCTCGAGATCCATTGAGAATGCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1428s1c1
Sequence:CCGGCCCAAGGTTTCTGCTAGAGATCTCGAGATCTCTAGCAGAAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014848
SV2B MISSION shRNA shRNA Plasmid DNA
synaptic vesicle glycoprotein 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014848.4-1792s21c1
Sequence:CCGGGATGAAGAATACAAGTCTAAACTCGAGTTTAGACTTGTATTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014848.4-2057s21c1
Sequence:CCGGAGTTCATCAACTGTCGGTTTACTCGAGTAAACCGACAGTTGATGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1839s1c1
Sequence:CCGGCGCCACAATCAACTTCACGATCTCGAGATCGTGAAGTTGATTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1519s1c1
Sequence:CCGGCCAGAGAAAGTGTTCACGGTTCTCGAGAACCGTGAACACTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-2121s1c1
Sequence:CCGGGCAAGATAATGACTTCCTGATCTCGAGATCAGGAAGTCATTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-2405s1c1
Sequence:CCGGCCTTCGGCATTCTCAATGGATCTCGAGATCCATTGAGAATGCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1428s1c1
Sequence:CCGGCCCAAGGTTTCTGCTAGAGATCTCGAGATCTCTAGCAGAAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014848
SV2B MISSION shRNA Lentiviral Transduction Particles
synaptic vesicle glycoprotein 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014848.4-1792s21c1
Sequence:CCGGGATGAAGAATACAAGTCTAAACTCGAGTTTAGACTTGTATTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014848.4-2057s21c1
Sequence:CCGGAGTTCATCAACTGTCGGTTTACTCGAGTAAACCGACAGTTGATGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1839s1c1
Sequence:CCGGCGCCACAATCAACTTCACGATCTCGAGATCGTGAAGTTGATTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1519s1c1
Sequence:CCGGCCAGAGAAAGTGTTCACGGTTCTCGAGAACCGTGAACACTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-2121s1c1
Sequence:CCGGGCAAGATAATGACTTCCTGATCTCGAGATCAGGAAGTCATTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-2405s1c1
Sequence:CCGGCCTTCGGCATTCTCAATGGATCTCGAGATCCATTGAGAATGCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014848.2-1428s1c1
Sequence:CCGGCCCAAGGTTTCTGCTAGAGATCTCGAGATCTCTAGCAGAAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153579
SV2B MISSION shRNA Bacterial Glycerol Stock
synaptic vesicle glycoprotein 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153579.3-3778s1c1
Sequence:CCGGCCCAAATCTAAACCAAACTAACTCGAGTTAGTTTGGTTTAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1092s1c1
Sequence:CCGGGCCTGGATGATTCTCAAACAACTCGAGTTGTTTGAGAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1466s1c1
Sequence:CCGGCGCCACGATCAACTTTACCATCTCGAGATGGTAAAGTTGATCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-432s1c1
Sequence:CCGGCACCAATATGAGACCATCATTCTCGAGAATGATGGTCTCATATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1032s1c1
Sequence:CCGGGCTCTGAAGTTCATGCCAGAACTCGAGTTCTGGCATGAACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153579
SV2B MISSION shRNA shRNA Plasmid DNA
synaptic vesicle glycoprotein 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153579.3-3778s1c1
Sequence:CCGGCCCAAATCTAAACCAAACTAACTCGAGTTAGTTTGGTTTAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1092s1c1
Sequence:CCGGGCCTGGATGATTCTCAAACAACTCGAGTTGTTTGAGAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1466s1c1
Sequence:CCGGCGCCACGATCAACTTTACCATCTCGAGATGGTAAAGTTGATCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-432s1c1
Sequence:CCGGCACCAATATGAGACCATCATTCTCGAGAATGATGGTCTCATATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1032s1c1
Sequence:CCGGGCTCTGAAGTTCATGCCAGAACTCGAGTTCTGGCATGAACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153579
SV2B MISSION shRNA Lentiviral Transduction Particles
synaptic vesicle glycoprotein 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153579.3-3778s1c1
Sequence:CCGGCCCAAATCTAAACCAAACTAACTCGAGTTAGTTTGGTTTAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1092s1c1
Sequence:CCGGGCCTGGATGATTCTCAAACAACTCGAGTTGTTTGAGAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1466s1c1
Sequence:CCGGCGCCACGATCAACTTTACCATCTCGAGATGGTAAAGTTGATCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-432s1c1
Sequence:CCGGCACCAATATGAGACCATCATTCTCGAGAATGATGGTCTCATATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153579.3-1032s1c1
Sequence:CCGGGCTCTGAAGTTCATGCCAGAACTCGAGTTCTGGCATGAACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks