EMAIL THIS PAGE TO A FRIEND

SV2C

synaptic vesicle glycoprotein 2C

UniProtKB ID: Q496J9, Q496K1, Q9UPU8
Gene ID:
Mouse(75209) synaptic vesicle glycoprotein 2c
Rat(29643) synaptic vesicle glycoprotein 2c
Zebrafish(562345) synaptic vesicle glycoprotein 2C
chicken(431597) synaptic vesicle glycoprotein 2C
Horse(100065509) synaptic vesicle glycoprotein 2C
domestic cat(101100360) synaptic vesicle glycoprotein 2C
dog(488943) synaptic vesicle glycoprotein 2C
naked mole-rat(101707001) synaptic vesicle glycoprotein 2C
domestic guinea pig(100734817) synaptic vesicle glycoprotein 2C
cow(538430) synaptic vesicle glycoprotein 2C
sheep(101110415) synaptic vesicle glycoprotein 2C
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014979 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014979 Rosetta Predictions human pricing
NM_031593 Rosetta Predictions rat pricing
XM_914033 Rosetta Predictions mouse pricing
XM_923035 Rosetta Predictions mouse pricing
XM_991257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066968 predicted 1855
2 SASI_Hs01_00066969 predicted 1945
3 SASI_Hs02_00346697 predicted 1617
4 SASI_Hs01_00066971 predicted 1467
5 SASI_Hs01_00066972 predicted 1919
6 SASI_Hs02_00346698 predicted 1421
7 SASI_Hs01_00066973 predicted 1521
8 SASI_Hs01_00066977 predicted 1900
9 SASI_Hs02_00346699 predicted 1639
10 SASI_Hs02_00346700 predicted 315
11 SASI_Hs01_00066970 predicted 1690
12 SASI_Hs01_00066974 predicted 1731
13 SASI_Hs01_00066975 predicted 1340
14 SASI_Hs01_00066976 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106457 predicted 1635
2 SASI_Rn01_00106458 predicted 1733
3 SASI_Rn01_00106459 predicted 1377
4 SASI_Rn01_00106460 predicted 528
5 SASI_Rn01_00106461 predicted 1077
6 SASI_Rn02_00264865 predicted 1752
7 SASI_Rn01_00106462 predicted 1512
8 SASI_Rn01_00106464 predicted 1940
9 SASI_Rn01_00106465 predicted 1874
10 SASI_Rn01_00106466 predicted 1527
11 SASI_Rn01_00106463 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438253 predicted 1734
2 SASI_Mm02_00438254 predicted 1520
3 SASI_Mm02_00438255 predicted 1727
4 SASI_Mm02_00438256 predicted 1867
5 SASI_Mm02_00438257 predicted 1757
6 SASI_Mm02_00438258 predicted 1475
7 SASI_Mm02_00438259 predicted 1908
8 SASI_Mm02_00438260 predicted 1658
9 SASI_Mm02_00438261 predicted 1972
10 SASI_Mm02_00438262 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443665 predicted 1515
2 SASI_Mm02_00443666 predicted 1300
3 SASI_Mm02_00443667 predicted 1503
4 SASI_Mm02_00443668 predicted 1652
5 SASI_Mm02_00443669 predicted 1587
6 SASI_Mm02_00443670 predicted 1534
7 SASI_Mm02_00443671 predicted 1682
8 SASI_Mm02_00443672 predicted 1435
9 SASI_Mm02_00443673 predicted 1750
10 SASI_Mm02_00443674 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450672 predicted 873
2 SASI_Mm02_00450673 predicted 671
3 SASI_Mm02_00450674 predicted 770
4 SASI_Mm02_00450675 predicted 892
5 SASI_Mm02_00450676 predicted 758
6 SASI_Mm02_00450677 predicted 640
7 SASI_Mm02_00450678 predicted 786
8 SASI_Mm02_00450679 predicted 901
9 SASI_Mm02_00450680 predicted 537
10 SASI_Mm02_00450681 predicted 563
11 SASI_Mm01_00275259 predicted 1746
12 SASI_Mm01_00275260 predicted 1524
13 SASI_Mm01_00275261 predicted 1725
14 SASI_Mm01_00275262 predicted 1878
15 SASI_Mm01_00275263 predicted 1810
16 SASI_Mm01_00275264 predicted 1765
17 SASI_Mm01_00275265 predicted 1479
18 SASI_Mm01_00275266 predicted 1663
19 SASI_Mm01_00275267 predicted 1969
20 SASI_Mm01_00275268 predicted 1915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014979
SV2C MISSION shRNA Bacterial Glycerol Stock
synaptic vesicle glycoprotein 2C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-185s1c1
Sequence:CCGGCATTGCCAGAGAGGTGAAGAACTCGAGTTCTTCACCTCTCTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014979.1-276s1c1
Sequence:CCGGCGGTTCCAAGATGAAGAAGATCTCGAGATCTTCTTCATCTTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-846s1c1
Sequence:CCGGGTCCAAGGTTATGGCTTCTTTCTCGAGAAAGAAGCCATAACCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-2149s1c1
Sequence:CCGGGCTTCTTAAATGCGCTATGCACTCGAGTGCATAGCGCATTTAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-918s1c1
Sequence:CCGGGTGTTCTCGTACTTTGCTGAACTCGAGTTCAGCAAAGTACGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-345s1c1
Sequence:CCGGGATGACGAAGGCTCAAGTGAACTCGAGTTCACTTGAGCCTTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014979.1-768s1c1
Sequence:CCGGGCAGACAAAGTGGGAAGGAAACTCGAGTTTCCTTCCCACTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014979
SV2C MISSION shRNA shRNA Plasmid DNA
synaptic vesicle glycoprotein 2C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-185s1c1
Sequence:CCGGCATTGCCAGAGAGGTGAAGAACTCGAGTTCTTCACCTCTCTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014979.1-276s1c1
Sequence:CCGGCGGTTCCAAGATGAAGAAGATCTCGAGATCTTCTTCATCTTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-846s1c1
Sequence:CCGGGTCCAAGGTTATGGCTTCTTTCTCGAGAAAGAAGCCATAACCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-2149s1c1
Sequence:CCGGGCTTCTTAAATGCGCTATGCACTCGAGTGCATAGCGCATTTAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-918s1c1
Sequence:CCGGGTGTTCTCGTACTTTGCTGAACTCGAGTTCAGCAAAGTACGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-345s1c1
Sequence:CCGGGATGACGAAGGCTCAAGTGAACTCGAGTTCACTTGAGCCTTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014979.1-768s1c1
Sequence:CCGGGCAGACAAAGTGGGAAGGAAACTCGAGTTTCCTTCCCACTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014979
SV2C MISSION shRNA Lentiviral Transduction Particles
synaptic vesicle glycoprotein 2C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-185s1c1
Sequence:CCGGCATTGCCAGAGAGGTGAAGAACTCGAGTTCTTCACCTCTCTGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014979.1-276s1c1
Sequence:CCGGCGGTTCCAAGATGAAGAAGATCTCGAGATCTTCTTCATCTTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-846s1c1
Sequence:CCGGGTCCAAGGTTATGGCTTCTTTCTCGAGAAAGAAGCCATAACCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-2149s1c1
Sequence:CCGGGCTTCTTAAATGCGCTATGCACTCGAGTGCATAGCGCATTTAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-918s1c1
Sequence:CCGGGTGTTCTCGTACTTTGCTGAACTCGAGTTCAGCAAAGTACGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014979.1-345s1c1
Sequence:CCGGGATGACGAAGGCTCAAGTGAACTCGAGTTCACTTGAGCCTTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014979.1-768s1c1
Sequence:CCGGGCAGACAAAGTGGGAAGGAAACTCGAGTTTCCTTCCCACTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029210
SV2C MISSION shRNA Bacterial Glycerol Stock
synaptic vesicle glycoprotein 2C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029210.1-2536s21c1
Sequence:CCGGGTAACGTGTAGCTGCGTATTGCTCGAGCAATACGCAGCTACACGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1464s21c1
Sequence:CCGGCACCGAACTGTACGGAATTTGCTCGAGCAAATTCCGTACAGTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1354s21c1
Sequence:CCGGGAGAAGGTCTTCACGGTAAATCTCGAGATTTACCGTGAAGACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1825s21c1
Sequence:CCGGTTCAAGAACTGCACGTTTATTCTCGAGAATAAACGTGCAGTTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1396s21c1
Sequence:CCGGATAGATGAGCTGATCGAAATTCTCGAGAATTTCGATCAGCTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029210
SV2C MISSION shRNA shRNA Plasmid DNA
synaptic vesicle glycoprotein 2C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029210.1-2536s21c1
Sequence:CCGGGTAACGTGTAGCTGCGTATTGCTCGAGCAATACGCAGCTACACGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1464s21c1
Sequence:CCGGCACCGAACTGTACGGAATTTGCTCGAGCAAATTCCGTACAGTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1354s21c1
Sequence:CCGGGAGAAGGTCTTCACGGTAAATCTCGAGATTTACCGTGAAGACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1825s21c1
Sequence:CCGGTTCAAGAACTGCACGTTTATTCTCGAGAATAAACGTGCAGTTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1396s21c1
Sequence:CCGGATAGATGAGCTGATCGAAATTCTCGAGAATTTCGATCAGCTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029210
SV2C MISSION shRNA Lentiviral Transduction Particles
synaptic vesicle glycoprotein 2C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029210.1-2536s21c1
Sequence:CCGGGTAACGTGTAGCTGCGTATTGCTCGAGCAATACGCAGCTACACGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1464s21c1
Sequence:CCGGCACCGAACTGTACGGAATTTGCTCGAGCAAATTCCGTACAGTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1354s21c1
Sequence:CCGGGAGAAGGTCTTCACGGTAAATCTCGAGATTTACCGTGAAGACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1825s21c1
Sequence:CCGGTTCAAGAACTGCACGTTTATTCTCGAGAATAAACGTGCAGTTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029210.1-1396s21c1
Sequence:CCGGATAGATGAGCTGATCGAAATTCTCGAGAATTTCGATCAGCTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks