EMAIL THIS PAGE TO A FRIEND

SVEP1

sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1

Synonyms: C9orf13 CCP22 POLYDOM SEL-OB SELOB
Gene ID:
Mouse(64817) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Rat(685899) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
chicken(427338) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
dog(474799) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
domestic cat(101100007) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Horse(100053852) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
sheep(101113459) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
domestic guinea pig(100714730) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
naked mole-rat(101716836) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Domestic Rabbit(100357966) sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153366 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153366 Rosetta Predictions human pricing
XM_928623 Rosetta Predictions human pricing
XM_933006 Rosetta Predictions human pricing
XM_933010 Rosetta Predictions human pricing
XM_933016 Rosetta Predictions human pricing
XM_933020 Rosetta Predictions human pricing
XM_933024 Rosetta Predictions human pricing
XM_001065678 Rosetta Predictions rat pricing
NM_022814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367235 predicted 6308
2 SASI_Hs02_00367236 predicted 5960
3 SASI_Hs02_00367237 predicted 2070
4 SASI_Hs02_00367238 predicted 6783
5 SASI_Hs02_00367239 predicted 8710
6 SASI_Hs02_00367240 predicted 6044
7 SASI_Hs02_00367241 predicted 4327
8 SASI_Hs02_00367242 predicted 6392
9 SASI_Hs02_00367243 predicted 10610
10 SASI_Hs02_00367244 predicted 4827
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300692 predicted 7331
2 SASI_Hs01_00300693 predicted 7315
3 SASI_Hs01_00300694 predicted 7404
4 SASI_Hs01_00300695 predicted 7407
5 SASI_Hs01_00300696 predicted 7228
6 SASI_Hs01_00300697 predicted 7289
7 SASI_Hs01_00300698 predicted 7415
8 SASI_Hs01_00300699 predicted 7330
9 SASI_Hs01_00300700 predicted 7303
10 SASI_Hs01_00300701 predicted 7225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287289 predicted 730
2 SASI_Hs01_00287290 predicted 918
3 SASI_Hs01_00287291 predicted 957
4 SASI_Hs01_00287292 predicted 1937
5 SASI_Hs01_00287293 predicted 1924
6 SASI_Hs01_00287294 predicted 1032
7 SASI_Hs01_00287295 predicted 1777
8 SASI_Hs01_00287296 predicted 864
9 SASI_Hs01_00287297 predicted 277
10 SASI_Hs01_00287298 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290864 predicted 309
2 SASI_Hs01_00290865 predicted 828
3 SASI_Hs01_00290866 predicted 609
4 SASI_Hs01_00290867 predicted 538
5 SASI_Hs01_00290868 predicted 497
6 SASI_Hs01_00290869 predicted 922
7 SASI_Hs01_00290870 predicted 835
8 SASI_Hs01_00290871 predicted 579
9 SASI_Hs01_00290872 predicted 584
10 SASI_Hs01_00290873 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276129 predicted 1544
2 SASI_Hs01_00276130 predicted 1542
3 SASI_Hs01_00276131 predicted 1519
4 SASI_Hs01_00276132 predicted 1349
5 SASI_Hs01_00276133 predicted 1475
6 SASI_Hs01_00276134 predicted 1475
7 SASI_Hs01_00276135 predicted 1379
8 SASI_Hs01_00276136 predicted 1475
9 SASI_Hs01_00276137 predicted 1452
10 SASI_Hs01_00276138 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289106 predicted 860
2 SASI_Hs01_00289107 predicted 1056
3 SASI_Hs01_00289108 predicted 1087
4 SASI_Hs01_00289109 predicted 2070
5 SASI_Hs01_00289110 predicted 2057
6 SASI_Hs01_00289111 predicted 1166
7 SASI_Hs01_00289112 predicted 1909
8 SASI_Hs01_00289113 predicted 997
9 SASI_Hs01_00289114 predicted 419
10 SASI_Hs01_00289115 predicted 2182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283479 predicted 7331
2 SASI_Hs01_00283480 predicted 7312
3 SASI_Hs01_00283481 predicted 7412
4 SASI_Hs01_00283482 predicted 7409
5 SASI_Hs01_00283483 predicted 7221
6 SASI_Hs01_00283484 predicted 7288
7 SASI_Hs01_00283485 predicted 7424
8 SASI_Hs01_00283486 predicted 7329
9 SASI_Hs01_00283487 predicted 7302
10 SASI_Hs01_00283488 predicted 7223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314993 predicted 7920
2 SASI_Rn02_00314994 predicted 7188
3 SASI_Rn02_00314995 predicted 7310
4 SASI_Rn02_00314996 predicted 605
5 SASI_Rn02_00314997 predicted 6073
6 SASI_Rn02_00314998 predicted 4934
7 SASI_Rn02_00314999 predicted 4659
8 SASI_Rn02_00315000 predicted 1244
9 SASI_Rn02_00315001 predicted 922
10 SASI_Rn02_00315002 predicted 2276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178645 predicted 6910
2 SASI_Mm01_00178647 predicted 3422
3 SASI_Mm01_00178648 predicted 2451
4 SASI_Mm01_00178649 predicted 5027
5 SASI_Mm01_00178650 predicted 9652
6 SASI_Mm01_00178651 predicted 4559
7 SASI_Mm01_00178652 predicted 7224
8 SASI_Mm02_00326660 predicted 8819
9 SASI_Mm02_00326661 predicted 1151
10 SASI_Mm01_00178653 predicted 3478
11 SASI_Mm01_00178646 predicted 7770
12 SASI_Mm01_00178654 predicted 2194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022814
VALIDATED
SVEP1 MISSION shRNA Bacterial Glycerol Stock
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022814.1-3038s1c1
Sequence:CCGGCGACTCATTAAGACATTGGAACTCGAGTTCCAATGTCTTAATGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022814.1-753s1c1
Sequence:CCGGCGCAAATCCTTCGTCACTCTACTCGAGTAGAGTGACGAAGGATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022814.1-9450s1c1
Sequence:CCGGCGGAGGACAATGTGGTAACTTCTCGAGAAGTTACCACATTGTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022814.1-4175s1c1
Sequence:CCGGGCAGTTTGTAAAGACCAAGTTCTCGAGAACTTGGTCTTTACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022814.1-9118s1c1
Sequence:CCGGCCACATACAGTATCAGTGTTTCTCGAGAAACACTGATACTGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-3428s21c1
Sequence:CCGGTCGTGTCCGCTGGGTACTTATCTCGAGATAAGTACCCAGCGGACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-1189s21c1
Sequence:CCGGTTGCCCATCAGGGACATATAACTCGAGTTATATGTCCCTGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022814.2-11094s1c1
Sequence:CCGGCTTACATGTGTGCGTTGTTTACTCGAGTAAACAACGCACACATGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022814.2-7938s21c1
Sequence:CCGGACGGTGCCATGATCATCTATACTCGAGTATAGATGATCATGGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-11095s21c1
Sequence:CCGGTTACATGTGTGCGTTGTTTAACTCGAGTTAAACAACGCACACATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-753s21c1
Sequence:CCGGCGCAAATCCTTCGTCACTCTACTCGAGTAGAGTGACGAAGGATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022814
VALIDATED
SVEP1 MISSION shRNA shRNA Plasmid DNA
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022814.1-3038s1c1
Sequence:CCGGCGACTCATTAAGACATTGGAACTCGAGTTCCAATGTCTTAATGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022814.1-753s1c1
Sequence:CCGGCGCAAATCCTTCGTCACTCTACTCGAGTAGAGTGACGAAGGATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022814.1-9450s1c1
Sequence:CCGGCGGAGGACAATGTGGTAACTTCTCGAGAAGTTACCACATTGTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022814.1-4175s1c1
Sequence:CCGGGCAGTTTGTAAAGACCAAGTTCTCGAGAACTTGGTCTTTACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022814.1-9118s1c1
Sequence:CCGGCCACATACAGTATCAGTGTTTCTCGAGAAACACTGATACTGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-3428s21c1
Sequence:CCGGTCGTGTCCGCTGGGTACTTATCTCGAGATAAGTACCCAGCGGACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-1189s21c1
Sequence:CCGGTTGCCCATCAGGGACATATAACTCGAGTTATATGTCCCTGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022814.2-11094s1c1
Sequence:CCGGCTTACATGTGTGCGTTGTTTACTCGAGTAAACAACGCACACATGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022814.2-7938s21c1
Sequence:CCGGACGGTGCCATGATCATCTATACTCGAGTATAGATGATCATGGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-11095s21c1
Sequence:CCGGTTACATGTGTGCGTTGTTTAACTCGAGTTAAACAACGCACACATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-753s21c1
Sequence:CCGGCGCAAATCCTTCGTCACTCTACTCGAGTAGAGTGACGAAGGATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022814
VALIDATED
SVEP1 MISSION shRNA Lentiviral Transduction Particles
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022814.1-3038s1c1
Sequence:CCGGCGACTCATTAAGACATTGGAACTCGAGTTCCAATGTCTTAATGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022814.1-753s1c1
Sequence:CCGGCGCAAATCCTTCGTCACTCTACTCGAGTAGAGTGACGAAGGATTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022814.1-9450s1c1
Sequence:CCGGCGGAGGACAATGTGGTAACTTCTCGAGAAGTTACCACATTGTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022814.1-4175s1c1
Sequence:CCGGGCAGTTTGTAAAGACCAAGTTCTCGAGAACTTGGTCTTTACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022814.1-9118s1c1
Sequence:CCGGCCACATACAGTATCAGTGTTTCTCGAGAAACACTGATACTGTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-3428s21c1
Sequence:CCGGTCGTGTCCGCTGGGTACTTATCTCGAGATAAGTACCCAGCGGACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-1189s21c1
Sequence:CCGGTTGCCCATCAGGGACATATAACTCGAGTTATATGTCCCTGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022814.2-11094s1c1
Sequence:CCGGCTTACATGTGTGCGTTGTTTACTCGAGTAAACAACGCACACATGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022814.2-7938s21c1
Sequence:CCGGACGGTGCCATGATCATCTATACTCGAGTATAGATGATCATGGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-11095s21c1
Sequence:CCGGTTACATGTGTGCGTTGTTTAACTCGAGTTAAACAACGCACACATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022814.2-753s21c1
Sequence:CCGGCGCAAATCCTTCGTCACTCTACTCGAGTAGAGTGACGAAGGATTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153366
SVEP1 MISSION shRNA Bacterial Glycerol Stock
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-5198s21c1
Sequence:CCGGATCGATTCTAAGAGCATATTTCTCGAGAAATATGCTCTTAGAATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-2658s21c1
Sequence:CCGGGCGTCTGGAAACCAACATATACTCGAGTATATGTTGGTTTCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153366.3-11656s21c1
Sequence:CCGGTTAGGGTAGCCTGGCTAATTCCTCGAGGAATTAGCCAGGCTACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-5625s21c1
Sequence:CCGGACGTAGATGGATCCTACATATCTCGAGATATGTAGGATCCATCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-3029s21c1
Sequence:CCGGGCCAAGTCCTCACGGATTAAACTCGAGTTTAATCCGTGAGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153366
SVEP1 MISSION shRNA shRNA Plasmid DNA
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-5198s21c1
Sequence:CCGGATCGATTCTAAGAGCATATTTCTCGAGAAATATGCTCTTAGAATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-2658s21c1
Sequence:CCGGGCGTCTGGAAACCAACATATACTCGAGTATATGTTGGTTTCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153366.3-11656s21c1
Sequence:CCGGTTAGGGTAGCCTGGCTAATTCCTCGAGGAATTAGCCAGGCTACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-5625s21c1
Sequence:CCGGACGTAGATGGATCCTACATATCTCGAGATATGTAGGATCCATCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-3029s21c1
Sequence:CCGGGCCAAGTCCTCACGGATTAAACTCGAGTTTAATCCGTGAGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153366
SVEP1 MISSION shRNA Lentiviral Transduction Particles
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-5198s21c1
Sequence:CCGGATCGATTCTAAGAGCATATTTCTCGAGAAATATGCTCTTAGAATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-2658s21c1
Sequence:CCGGGCGTCTGGAAACCAACATATACTCGAGTATATGTTGGTTTCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153366.3-11656s21c1
Sequence:CCGGTTAGGGTAGCCTGGCTAATTCCTCGAGGAATTAGCCAGGCTACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-5625s21c1
Sequence:CCGGACGTAGATGGATCCTACATATCTCGAGATATGTAGGATCCATCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153366.3-3029s21c1
Sequence:CCGGGCCAAGTCCTCACGGATTAAACTCGAGTTTAATCCGTGAGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks