EMAIL THIS PAGE TO A FRIEND

SVIL

supervillin

Gene ID:
Human(6840) Summary: This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Two transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Jul 2008]
Mouse(225115) supervillin
Rat(361256) supervillin
chicken(420475) supervillin
dog(477965) supervillin
Horse(100063045) supervillin
cow(281509) supervillin
sheep(101119493) supervillin
Gene Class: Cytoskeleton
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003174 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003174 Rosetta Predictions human pricing
NM_021738 Rosetta Predictions human pricing
NM_001108416 Rosetta Predictions rat pricing
NM_153153 Rosetta Predictions mouse pricing
NM_178046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064640 predicted 4039
2 SASI_Hs02_00335194 predicted 3722
3 SASI_Hs02_00335195 predicted 832
4 SASI_Hs01_00064641 predicted 2556
5 SASI_Hs02_00335196 predicted 3482
6 SASI_Hs01_00064643 predicted 3849
7 SASI_Hs02_00335197 predicted 3074
8 SASI_Hs01_00064645 predicted 2463
9 SASI_Hs01_00064646 predicted 3824
10 SASI_Hs01_00064647 predicted 2030
11 SASI_Hs01_00064642 predicted 5511
12 SASI_Hs01_00064644 predicted 4802
13 SASI_Hs01_00064648 predicted 5037
14 SASI_Hs01_00064649 predicted 4302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154814 predicted 5619
2 SASI_Hs02_00355086 predicted 5305
3 SASI_Hs02_00355087 predicted 1140
4 SASI_Hs01_00154815 predicted 4132
5 SASI_Hs02_00355088 predicted 5066
6 SASI_Hs01_00154817 predicted 5428
7 SASI_Hs02_00355089 predicted 4654
8 SASI_Hs01_00154819 predicted 4044
9 SASI_Hs01_00154820 predicted 5408
10 SASI_Hs01_00154821 predicted 3611
11 SASI_Hs01_00154816 predicted 7087
12 SASI_Hs01_00154818 predicted 6380
13 SASI_Hs01_00154822 predicted 6620
14 SASI_Hs01_00154823 predicted 5874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238439 predicted 408
2 SASI_Rn02_00238440 predicted 227
3 SASI_Rn02_00238441 predicted 293
4 SASI_Rn02_00238442 predicted 267
5 SASI_Rn02_00238443 predicted 681
6 SASI_Rn02_00238444 predicted 94
7 SASI_Rn02_00238445 predicted 682
8 SASI_Rn02_00238446 predicted 456
9 SASI_Rn02_00238447 predicted 189
10 SASI_Rn02_00238448 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343037 predicted 5887
2 SASI_Mm02_00343038 predicted 1522
3 SASI_Mm01_00124957 predicted 5052
4 SASI_Mm01_00124958 predicted 2937
5 SASI_Mm02_00343039 predicted 4484
6 SASI_Mm01_00124961 predicted 296
7 SASI_Mm01_00124962 predicted 2077
8 SASI_Mm01_00124963 predicted 4553
9 SASI_Mm01_00124964 predicted 959
10 SASI_Mm01_00124965 predicted 3540
11 SASI_Mm01_00124959 predicted 4928
12 SASI_Mm01_00124960 predicted 1481
13 SASI_Mm01_00124966 predicted 4719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109586 predicted 887
2 SASI_Mm01_00109587 predicted 940
3 SASI_Mm02_00348502 predicted 809
4 SASI_Mm01_00109589 predicted 747
5 SASI_Mm01_00109590 predicted 793
6 SASI_Mm02_00348503 predicted 810
7 SASI_Mm01_00109591 predicted 760
8 SASI_Mm01_00109592 predicted 745
9 SASI_Mm02_00348504 predicted 1008
10 SASI_Mm01_00109594 predicted 803
11 SASI_Mm01_00109588 predicted 894
12 SASI_Mm01_00109593 predicted 927
13 SASI_Mm01_00109595 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003174
VALIDATED
SVIL MISSION shRNA Bacterial Glycerol Stock
supervillin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003174.3-5866s21c1
Sequence:CCCGGCACCAGGGAAATGGATATATCTCGAGATATATCCATTTCCCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-3658s21c1
Sequence:CCGGGCCTCAGAACTTGCAACTTTACTCGAGTAAAGTTGCAAGTTCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-2128s21c1
Sequence:CCGGGACAGCCATAAGGAATCTAAACTCGAGTTTAGATTCCTTATGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-2465s21c1
Sequence:CCGGAGAATCCATGTGCGATGTTTGCTCGAGCAAACATCGCACATGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003174.2-664s1c1
Sequence:CCGGCGATCCAAATACTGCACAGAACTCGAGTTCTGTGCAGTATTTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-839s1c1
Sequence:CCGGCCGAGTATTTATCCCGCTATACTCGAGTATAGCGGGATAAATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-3709s1c1
Sequence:CCGGGCTACTTATATCCAAACCATTCTCGAGAATGGTTTGGATATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003174.2-6330s1c1
Sequence:CCGGGCCACCAATATGTATCTTCATCTCGAGATGAAGATACATATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-3721s1c1
Sequence:CCGGCAAACCATTGAAGAAGGAATTCTCGAGAATTCCTTCTTCAATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003174
VALIDATED
SVIL MISSION shRNA shRNA Plasmid DNA
supervillin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003174.3-5866s21c1
Sequence:CCCGGCACCAGGGAAATGGATATATCTCGAGATATATCCATTTCCCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-3658s21c1
Sequence:CCGGGCCTCAGAACTTGCAACTTTACTCGAGTAAAGTTGCAAGTTCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-2128s21c1
Sequence:CCGGGACAGCCATAAGGAATCTAAACTCGAGTTTAGATTCCTTATGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-2465s21c1
Sequence:CCGGAGAATCCATGTGCGATGTTTGCTCGAGCAAACATCGCACATGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003174.2-664s1c1
Sequence:CCGGCGATCCAAATACTGCACAGAACTCGAGTTCTGTGCAGTATTTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-839s1c1
Sequence:CCGGCCGAGTATTTATCCCGCTATACTCGAGTATAGCGGGATAAATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-3709s1c1
Sequence:CCGGGCTACTTATATCCAAACCATTCTCGAGAATGGTTTGGATATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003174.2-6330s1c1
Sequence:CCGGGCCACCAATATGTATCTTCATCTCGAGATGAAGATACATATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-3721s1c1
Sequence:CCGGCAAACCATTGAAGAAGGAATTCTCGAGAATTCCTTCTTCAATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003174
VALIDATED
SVIL MISSION shRNA Lentiviral Transduction Particles
supervillin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003174.3-5866s21c1
Sequence:CCCGGCACCAGGGAAATGGATATATCTCGAGATATATCCATTTCCCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-3658s21c1
Sequence:CCGGGCCTCAGAACTTGCAACTTTACTCGAGTAAAGTTGCAAGTTCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-2128s21c1
Sequence:CCGGGACAGCCATAAGGAATCTAAACTCGAGTTTAGATTCCTTATGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003174.3-2465s21c1
Sequence:CCGGAGAATCCATGTGCGATGTTTGCTCGAGCAAACATCGCACATGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003174.2-664s1c1
Sequence:CCGGCGATCCAAATACTGCACAGAACTCGAGTTCTGTGCAGTATTTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-839s1c1
Sequence:CCGGCCGAGTATTTATCCCGCTATACTCGAGTATAGCGGGATAAATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-3709s1c1
Sequence:CCGGGCTACTTATATCCAAACCATTCTCGAGAATGGTTTGGATATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003174.2-6330s1c1
Sequence:CCGGGCCACCAATATGTATCTTCATCTCGAGATGAAGATACATATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003174.2-3721s1c1
Sequence:CCGGCAAACCATTGAAGAAGGAATTCTCGAGAATTCCTTCTTCAATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178046
SVIL MISSION shRNA Bacterial Glycerol Stock
supervillin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-676s1c1
Sequence:CCGGCCTCATATTGGGCGATCCAAACTCGAGTTTGGATCGCCCAATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-736s1c1
Sequence:CCGGACTCCTTCTAAATACTGCATACTCGAGTATGCAGTATTTAGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-942s1c1
Sequence:CCGGTGTGACTGAGAGACGAGGAAACTCGAGTTTCCTCGTCTCTCAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-1296s1c1
Sequence:CCGGGTACCCTTCTGGTTCAGAAATCTCGAGATTTCTGAACCAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-675s1c1
Sequence:CCGGCCCTCATATTGGGCGATCCAACTCGAGTTGGATCGCCCAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178046
SVIL MISSION shRNA shRNA Plasmid DNA
supervillin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-676s1c1
Sequence:CCGGCCTCATATTGGGCGATCCAAACTCGAGTTTGGATCGCCCAATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-736s1c1
Sequence:CCGGACTCCTTCTAAATACTGCATACTCGAGTATGCAGTATTTAGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-942s1c1
Sequence:CCGGTGTGACTGAGAGACGAGGAAACTCGAGTTTCCTCGTCTCTCAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-1296s1c1
Sequence:CCGGGTACCCTTCTGGTTCAGAAATCTCGAGATTTCTGAACCAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-675s1c1
Sequence:CCGGCCCTCATATTGGGCGATCCAACTCGAGTTGGATCGCCCAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178046
SVIL MISSION shRNA Lentiviral Transduction Particles
supervillin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-676s1c1
Sequence:CCGGCCTCATATTGGGCGATCCAAACTCGAGTTTGGATCGCCCAATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-736s1c1
Sequence:CCGGACTCCTTCTAAATACTGCATACTCGAGTATGCAGTATTTAGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-942s1c1
Sequence:CCGGTGTGACTGAGAGACGAGGAAACTCGAGTTTCCTCGTCTCTCAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-1296s1c1
Sequence:CCGGGTACCCTTCTGGTTCAGAAATCTCGAGATTTCTGAACCAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178046.2-675s1c1
Sequence:CCGGCCCTCATATTGGGCGATCCAACTCGAGTTGGATCGCCCAATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks