EMAIL THIS PAGE TO A FRIEND

SVIP

small VCP/p97-interacting protein

UniProtKB ID: Q8NHG7
Gene ID:
Mouse(75744) small VCP/p97-interacting protein
Rat(499157) small VCP/p97-interacting protein
dog(100500800) small VCP/p97-interacting protein
domestic guinea pig(100727755) small VCP/p97-interacting protein
naked mole-rat(101699221) small VCP/p97-interacting protein
cow(100300295) small VCP/p97-interacting protein
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148893 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016261 MISSION® esiRNA esiRNA targeting human SVIP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148893 Rosetta Predictions human pricing
XM_930226 Rosetta Predictions human pricing
XM_934479 Rosetta Predictions human pricing
XM_934482 Rosetta Predictions human pricing
XM_001080929 Rosetta Predictions rat pricing
XM_574455 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365596 predicted 579
2 SASI_Hs02_00365597 predicted 743
3 SASI_Hs02_00365598 predicted 602
4 SASI_Hs02_00365599 predicted 754
5 SASI_Hs02_00365600 predicted 669
6 SASI_Hs02_00365601 predicted 617
7 SASI_Hs02_00365602 predicted 302
8 SASI_Hs02_00365603 predicted 299
9 SASI_Hs02_00365604 predicted 316
10 SASI_Hs02_00365605 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287915 predicted 600
2 SASI_Hs01_00287916 predicted 774
3 SASI_Hs01_00287917 predicted 775
4 SASI_Hs01_00287918 predicted 694
5 SASI_Hs01_00287919 predicted 413
6 SASI_Hs01_00287920 predicted 328
7 SASI_Hs01_00287921 predicted 325
8 SASI_Hs01_00287922 predicted 628
9 SASI_Hs01_00287923 predicted 345
10 SASI_Hs01_00287924 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281799 predicted 398
2 SASI_Hs01_00281800 predicted 335
3 SASI_Hs01_00281801 predicted 391
4 SASI_Hs01_00281802 predicted 381
5 SASI_Hs01_00281803 predicted 312
6 SASI_Hs01_00281804 predicted 393
7 SASI_Hs01_00281805 predicted 307
8 SASI_Hs01_00281806 predicted 436
9 SASI_Hs01_00281807 predicted 316
10 SASI_Hs01_00281808 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267679 predicted 715
2 SASI_Hs01_00267680 predicted 878
3 SASI_Hs01_00267681 predicted 890
4 SASI_Hs01_00267682 predicted 809
5 SASI_Hs01_00267683 predicted 435
6 SASI_Hs01_00267684 predicted 432
7 SASI_Hs01_00267685 predicted 743
8 SASI_Hs01_00267686 predicted 233
9 SASI_Hs01_00267687 predicted 451
10 SASI_Hs01_00267688 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369880 predicted 435
2 SASI_Rn02_00369881 predicted 417
3 SASI_Rn02_00369882 predicted 683
4 SASI_Rn02_00369883 predicted 795
5 SASI_Rn02_00369884 predicted 733
6 SASI_Rn02_00369885 predicted 392
7 SASI_Rn02_00369886 predicted 453
8 SASI_Rn02_00369887 predicted 795
9 SASI_Rn02_00369888 predicted 495
10 SASI_Rn02_00369889 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402051 predicted 430
2 SASI_Rn02_00402052 predicted 409
3 SASI_Rn02_00402053 predicted 686
4 SASI_Rn02_00402054 predicted 801
5 SASI_Rn02_00402055 predicted 726
6 SASI_Rn02_00402056 predicted 386
7 SASI_Rn02_00402057 predicted 450
8 SASI_Rn02_00402058 predicted 788
9 SASI_Rn02_00402059 predicted 493
10 SASI_Rn02_00402060 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148893
VALIDATED
SVIP MISSION shRNA Bacterial Glycerol Stock
small VCP/p97-interacting protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-288s21c1
Sequence:CCGGCACCAGAAGGTGGACTTAGGTCTCGAGACCTAAGTCCACCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-320s21c1
Sequence:CCGGTAAAGCATAACATGAGTAGAACTCGAGTTCTACTCATGTTATGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-213s21c1
Sequence:CCGGTAGATGTTCAATCTGTGCAAGCTCGAGCTTGCACAGATTGAACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148893.1-1071s21c1
Sequence:CCGGATAATCTGGATGGGTTATAATCTCGAGATTATAACCCATCCAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-303s21c1
Sequence:CCGGTTAGGTGGACAGTTTCATAAACTCGAGTTTATGAAACTGTCCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148893
VALIDATED
SVIP MISSION shRNA shRNA Plasmid DNA
small VCP/p97-interacting protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-288s21c1
Sequence:CCGGCACCAGAAGGTGGACTTAGGTCTCGAGACCTAAGTCCACCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-320s21c1
Sequence:CCGGTAAAGCATAACATGAGTAGAACTCGAGTTCTACTCATGTTATGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-213s21c1
Sequence:CCGGTAGATGTTCAATCTGTGCAAGCTCGAGCTTGCACAGATTGAACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148893.1-1071s21c1
Sequence:CCGGATAATCTGGATGGGTTATAATCTCGAGATTATAACCCATCCAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-303s21c1
Sequence:CCGGTTAGGTGGACAGTTTCATAAACTCGAGTTTATGAAACTGTCCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148893
VALIDATED
SVIP MISSION shRNA Lentiviral Transduction Particles
small VCP/p97-interacting protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-288s21c1
Sequence:CCGGCACCAGAAGGTGGACTTAGGTCTCGAGACCTAAGTCCACCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-320s21c1
Sequence:CCGGTAAAGCATAACATGAGTAGAACTCGAGTTCTACTCATGTTATGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-213s21c1
Sequence:CCGGTAGATGTTCAATCTGTGCAAGCTCGAGCTTGCACAGATTGAACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148893.1-1071s21c1
Sequence:CCGGATAATCTGGATGGGTTATAATCTCGAGATTATAACCCATCCAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_148893.1-303s21c1
Sequence:CCGGTTAGGTGGACAGTTTCATAAACTCGAGTTTATGAAACTGTCCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks