EMAIL THIS PAGE TO A FRIEND

SVOP

SV2 related protein homolog (rat)

UniProtKB ID: Q8N4V2, Q9NPW5
Gene ID:
Mouse(68666) SV2 related protein
Rat(171442) SV2 related protein
chicken(416895) SV2 related protein homolog (rat)
dog(486316) SV2 related protein homolog (rat)
domestic cat(101094298) SV2 related protein homolog (rat)
cow(510256) SV2 related protein homolog (rat)
sheep(101102091) SV2 related protein homolog (rat)
naked mole-rat(101715538) SV2 related protein homolog (rat)
domestic guinea pig(100735501) SV2 related protein homolog (rat)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018711 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018711 Rosetta Predictions human pricing
NM_134404 Rosetta Predictions rat pricing
NM_026805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098022 predicted 1154
2 SASI_Hs01_00098023 predicted 1328
3 SASI_Hs01_00098024 predicted 771
4 SASI_Hs02_00352241 predicted 1472
5 SASI_Hs01_00098025 predicted 670
6 SASI_Hs01_00098026 predicted 1224
7 SASI_Hs01_00098027 predicted 1487
8 SASI_Hs01_00098028 predicted 269
9 SASI_Hs01_00098029 predicted 1779
10 SASI_Hs01_00098030 predicted 1789
11 SASI_Hs01_00098031 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054744 predicted 1849
2 SASI_Rn01_00054745 predicted 1424
3 SASI_Rn01_00054746 predicted 1121
4 SASI_Rn01_00054747 predicted 1085
5 SASI_Rn01_00054748 predicted 1099
6 SASI_Rn01_00054749 predicted 1795
7 SASI_Rn01_00054751 predicted 1233
8 SASI_Rn02_00267997 predicted 515
9 SASI_Rn01_00054752 predicted 1566
10 SASI_Rn02_00267998 predicted 314
11 SASI_Rn01_00054750 predicted 1219
12 SASI_Rn01_00054753 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146113 predicted 1474
2 SASI_Mm01_00146114 predicted 1491
3 SASI_Mm01_00146115 predicted 1175
4 SASI_Mm01_00146116 predicted 1133
5 SASI_Mm01_00146117 predicted 1284
6 SASI_Mm01_00146118 predicted 1481
7 SASI_Mm01_00146119 predicted 1268
8 SASI_Mm01_00146120 predicted 1457
9 SASI_Mm01_00146121 predicted 1606
10 SASI_Mm01_00146122 predicted 939
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026805
SVOP MISSION shRNA Bacterial Glycerol Stock
SV2 related protein homolog (rat)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026805.1-2423s1c1
Sequence:CCGGCCAATGAAAGTGCTTTGGAATCTCGAGATTCCAAAGCACTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-1513s1c1
Sequence:CCGGGCTTCCAAGCAGCCTATGTTTCTCGAGAAACATAGGCTGCTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-376s1c1
Sequence:CCGGCCAATCCCACTGATGACACTTCTCGAGAAGTGTCATCAGTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-933s1c1
Sequence:CCGGCCACTACTACTCTTCGCTGTTCTCGAGAACAGCGAAGAGTAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-1607s1c1
Sequence:CCGGCGCTCTCATTACTCCGTTCATCTCGAGATGAACGGAGTAATGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026805
SVOP MISSION shRNA shRNA Plasmid DNA
SV2 related protein homolog (rat)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026805.1-2423s1c1
Sequence:CCGGCCAATGAAAGTGCTTTGGAATCTCGAGATTCCAAAGCACTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-1513s1c1
Sequence:CCGGGCTTCCAAGCAGCCTATGTTTCTCGAGAAACATAGGCTGCTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-376s1c1
Sequence:CCGGCCAATCCCACTGATGACACTTCTCGAGAAGTGTCATCAGTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-933s1c1
Sequence:CCGGCCACTACTACTCTTCGCTGTTCTCGAGAACAGCGAAGAGTAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-1607s1c1
Sequence:CCGGCGCTCTCATTACTCCGTTCATCTCGAGATGAACGGAGTAATGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026805
SVOP MISSION shRNA Lentiviral Transduction Particles
SV2 related protein homolog (rat)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026805.1-2423s1c1
Sequence:CCGGCCAATGAAAGTGCTTTGGAATCTCGAGATTCCAAAGCACTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-1513s1c1
Sequence:CCGGGCTTCCAAGCAGCCTATGTTTCTCGAGAAACATAGGCTGCTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-376s1c1
Sequence:CCGGCCAATCCCACTGATGACACTTCTCGAGAAGTGTCATCAGTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-933s1c1
Sequence:CCGGCCACTACTACTCTTCGCTGTTCTCGAGAACAGCGAAGAGTAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026805.1-1607s1c1
Sequence:CCGGCGCTCTCATTACTCCGTTCATCTCGAGATGAACGGAGTAATGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018711
SVOP MISSION shRNA Bacterial Glycerol Stock
SV2 related protein homolog (rat)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018711.1-2388s1c1
Sequence:CCGGGCATTCAAACTGGAGCCACATCTCGAGATGTGGCTCCAGTTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-999s1c1
Sequence:CCGGCCACCTTAAAGAGGATAGCAACTCGAGTTGCTATCCTCTTTAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-368s1c1
Sequence:CCGGGATACTTTCATGGTGGAAGATCTCGAGATCTTCCACCATGAAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-355s1c1
Sequence:CCGGCAATCCCACTGATGATACTTTCTCGAGAAAGTATCATCAGTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018711.1-2540s1c1
Sequence:CCGGGCCAAAGTGAATCAAGCTGAACTCGAGTTCAGCTTGATTCACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-1154s1c1
Sequence:CCGGGCATTCTCTTACTACGGGTTACTCGAGTAACCCGTAGTAAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-777s1c1
Sequence:CCGGCCATGAAAGCCAGAGCTAAATCTCGAGATTTAGCTCTGGCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-269s1c1
Sequence:CCGGGAGCATGAAGTCCAGATTGAACTCGAGTTCAATCTGGACTTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-1333s1c1
Sequence:CCGGCCTTGTGACTCTGTGGATTATCTCGAGATAATCCACAGAGTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018711
SVOP MISSION shRNA shRNA Plasmid DNA
SV2 related protein homolog (rat)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018711.1-2388s1c1
Sequence:CCGGGCATTCAAACTGGAGCCACATCTCGAGATGTGGCTCCAGTTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-999s1c1
Sequence:CCGGCCACCTTAAAGAGGATAGCAACTCGAGTTGCTATCCTCTTTAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-368s1c1
Sequence:CCGGGATACTTTCATGGTGGAAGATCTCGAGATCTTCCACCATGAAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-355s1c1
Sequence:CCGGCAATCCCACTGATGATACTTTCTCGAGAAAGTATCATCAGTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018711.1-2540s1c1
Sequence:CCGGGCCAAAGTGAATCAAGCTGAACTCGAGTTCAGCTTGATTCACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-1154s1c1
Sequence:CCGGGCATTCTCTTACTACGGGTTACTCGAGTAACCCGTAGTAAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-777s1c1
Sequence:CCGGCCATGAAAGCCAGAGCTAAATCTCGAGATTTAGCTCTGGCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-269s1c1
Sequence:CCGGGAGCATGAAGTCCAGATTGAACTCGAGTTCAATCTGGACTTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-1333s1c1
Sequence:CCGGCCTTGTGACTCTGTGGATTATCTCGAGATAATCCACAGAGTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018711
SVOP MISSION shRNA Lentiviral Transduction Particles
SV2 related protein homolog (rat)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018711.1-2388s1c1
Sequence:CCGGGCATTCAAACTGGAGCCACATCTCGAGATGTGGCTCCAGTTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-999s1c1
Sequence:CCGGCCACCTTAAAGAGGATAGCAACTCGAGTTGCTATCCTCTTTAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-368s1c1
Sequence:CCGGGATACTTTCATGGTGGAAGATCTCGAGATCTTCCACCATGAAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-355s1c1
Sequence:CCGGCAATCCCACTGATGATACTTTCTCGAGAAAGTATCATCAGTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018711.1-2540s1c1
Sequence:CCGGGCCAAAGTGAATCAAGCTGAACTCGAGTTCAGCTTGATTCACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018711.1-1154s1c1
Sequence:CCGGGCATTCTCTTACTACGGGTTACTCGAGTAACCCGTAGTAAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-777s1c1
Sequence:CCGGCCATGAAAGCCAGAGCTAAATCTCGAGATTTAGCTCTGGCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-269s1c1
Sequence:CCGGGAGCATGAAGTCCAGATTGAACTCGAGTTCAATCTGGACTTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018711.1-1333s1c1
Sequence:CCGGCCTTGTGACTCTGTGGATTATCTCGAGATAATCCACAGAGTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks