EMAIL THIS PAGE TO A FRIEND

SVOPL

SVOP-like

UniProtKB ID: Q8N434
Gene ID:
Mouse(320590) SV2 related protein homolog (rat)-like
Zebrafish(492766) SVOP-like
dog(482780) SVOP-like
Horse(100066769) SVOP-like
chicken(418105) SVOP-like
cow(518832) SVOP-like
sheep(101109267) SVOP-like
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174959 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174959 Rosetta Predictions human pricing
NM_177200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137734 predicted 534
2 SASI_Hs01_00137735 predicted 259
3 SASI_Hs01_00137736 predicted 945
4 SASI_Hs01_00137737 predicted 270
5 SASI_Hs01_00137738 predicted 698
6 SASI_Hs01_00137739 predicted 420
7 SASI_Hs01_00137741 predicted 424
8 SASI_Hs01_00137742 predicted 418
9 SASI_Hs01_00137743 predicted 405
10 SASI_Hs02_00368896 predicted 746
11 SASI_Hs01_00137740 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107576 predicted 1108
2 SASI_Mm02_00347211 predicted 1529
3 SASI_Mm01_00107578 predicted 569
4 SASI_Mm02_00347212 predicted 1173
5 SASI_Mm01_00107579 predicted 750
6 SASI_Mm02_00347213 predicted 1667
7 SASI_Mm01_00107582 predicted 958
8 SASI_Mm02_00347214 predicted 1536
9 SASI_Mm02_00347215 predicted 754
10 SASI_Mm02_00347216 predicted 1173
11 SASI_Mm01_00107577 predicted 966
12 SASI_Mm01_00107580 predicted 1313
13 SASI_Mm01_00107581 predicted 1142
14 SASI_Mm01_00107583 predicted 1019
15 SASI_Mm01_00107584 predicted 921
16 SASI_Mm01_00107585 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174959
SVOPL MISSION shRNA Bacterial Glycerol Stock
SVOP-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-124s1c1
Sequence:CCGGCCGAGGCTATATGTTACCCTTCTCGAGAAGGGTAACATATAGCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-730s1c1
Sequence:CCGGGCTGAGCCTTTCTATTACCATCTCGAGATGGTAATAGAAAGGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1108s1c1
Sequence:CCGGGCTATGTCTACCAGATGAGAACTCGAGTTCTCATCTGGTAGACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-669s1c1
Sequence:CCGGCCATCGGTGAAATTGCTTTGACTCGAGTCAAAGCAATTTCACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1103s1c1
Sequence:CCGGGCAAAGCTATGTCTACCAGATCTCGAGATCTGGTAGACATAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1262s1c1
Sequence:CCGGGATCTCTTCCTTGAGGAACAACTCGAGTTGTTCCTCAAGGAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-425s1c1
Sequence:CCGGGCAGACCTATTGGATGCTAAACTCGAGTTTAGCATCCAATAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174959.1-114s1c1
Sequence:CCGGCCACGAAATACCGAGGCTATACTCGAGTATAGCCTCGGTATTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174959.1-1019s1c1
Sequence:CCGGGTCTGTGTTGTATGCGCCATTCTCGAGAATGGCGCATACAACACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-953s1c1
Sequence:CCGGGCGCCATTTATATCCCAGGTTCTCGAGAACCTGGGATATAAATGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174959
SVOPL MISSION shRNA shRNA Plasmid DNA
SVOP-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-124s1c1
Sequence:CCGGCCGAGGCTATATGTTACCCTTCTCGAGAAGGGTAACATATAGCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-730s1c1
Sequence:CCGGGCTGAGCCTTTCTATTACCATCTCGAGATGGTAATAGAAAGGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1108s1c1
Sequence:CCGGGCTATGTCTACCAGATGAGAACTCGAGTTCTCATCTGGTAGACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-669s1c1
Sequence:CCGGCCATCGGTGAAATTGCTTTGACTCGAGTCAAAGCAATTTCACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1103s1c1
Sequence:CCGGGCAAAGCTATGTCTACCAGATCTCGAGATCTGGTAGACATAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1262s1c1
Sequence:CCGGGATCTCTTCCTTGAGGAACAACTCGAGTTGTTCCTCAAGGAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-425s1c1
Sequence:CCGGGCAGACCTATTGGATGCTAAACTCGAGTTTAGCATCCAATAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174959.1-114s1c1
Sequence:CCGGCCACGAAATACCGAGGCTATACTCGAGTATAGCCTCGGTATTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174959.1-1019s1c1
Sequence:CCGGGTCTGTGTTGTATGCGCCATTCTCGAGAATGGCGCATACAACACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-953s1c1
Sequence:CCGGGCGCCATTTATATCCCAGGTTCTCGAGAACCTGGGATATAAATGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174959
SVOPL MISSION shRNA Lentiviral Transduction Particles
SVOP-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-124s1c1
Sequence:CCGGCCGAGGCTATATGTTACCCTTCTCGAGAAGGGTAACATATAGCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-730s1c1
Sequence:CCGGGCTGAGCCTTTCTATTACCATCTCGAGATGGTAATAGAAAGGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1108s1c1
Sequence:CCGGGCTATGTCTACCAGATGAGAACTCGAGTTCTCATCTGGTAGACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-669s1c1
Sequence:CCGGCCATCGGTGAAATTGCTTTGACTCGAGTCAAAGCAATTTCACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1103s1c1
Sequence:CCGGGCAAAGCTATGTCTACCAGATCTCGAGATCTGGTAGACATAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174959.1-1262s1c1
Sequence:CCGGGATCTCTTCCTTGAGGAACAACTCGAGTTGTTCCTCAAGGAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-425s1c1
Sequence:CCGGGCAGACCTATTGGATGCTAAACTCGAGTTTAGCATCCAATAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174959.1-114s1c1
Sequence:CCGGCCACGAAATACCGAGGCTATACTCGAGTATAGCCTCGGTATTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174959.1-1019s1c1
Sequence:CCGGGTCTGTGTTGTATGCGCCATTCTCGAGAATGGCGCATACAACACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174959.1-953s1c1
Sequence:CCGGGCGCCATTTATATCCCAGGTTCTCGAGAACCTGGGATATAAATGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177200
SVOPL MISSION shRNA Bacterial Glycerol Stock
SVOP-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177200.2-2299s1c1
Sequence:CCGGGCAGCCAAGAACAACAATATACTCGAGTATATTGTTGTTCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-1112s1c1
Sequence:CCGGCCCTGCTATTGCCACATATTTCTCGAGAAATATGTGGCAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-761s1c1
Sequence:CCGGGCCTTCAAGTTTATCCCTGAACTCGAGTTCAGGGATAAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-293s1c1
Sequence:CCGGGCCATGGAGATCATGTTAATACTCGAGTATTAACATGATCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-1181s1c1
Sequence:CCGGGCTTGTAAGATTGCCCATGTACTCGAGTACATGGGCAATCTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177200
SVOPL MISSION shRNA shRNA Plasmid DNA
SVOP-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177200.2-2299s1c1
Sequence:CCGGGCAGCCAAGAACAACAATATACTCGAGTATATTGTTGTTCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-1112s1c1
Sequence:CCGGCCCTGCTATTGCCACATATTTCTCGAGAAATATGTGGCAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-761s1c1
Sequence:CCGGGCCTTCAAGTTTATCCCTGAACTCGAGTTCAGGGATAAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-293s1c1
Sequence:CCGGGCCATGGAGATCATGTTAATACTCGAGTATTAACATGATCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-1181s1c1
Sequence:CCGGGCTTGTAAGATTGCCCATGTACTCGAGTACATGGGCAATCTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177200
SVOPL MISSION shRNA Lentiviral Transduction Particles
SVOP-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177200.2-2299s1c1
Sequence:CCGGGCAGCCAAGAACAACAATATACTCGAGTATATTGTTGTTCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-1112s1c1
Sequence:CCGGCCCTGCTATTGCCACATATTTCTCGAGAAATATGTGGCAATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-761s1c1
Sequence:CCGGGCCTTCAAGTTTATCCCTGAACTCGAGTTCAGGGATAAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-293s1c1
Sequence:CCGGGCCATGGAGATCATGTTAATACTCGAGTATTAACATGATCTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177200.2-1181s1c1
Sequence:CCGGGCTTGTAAGATTGCCCATGTACTCGAGTACATGGGCAATCTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks