EMAIL THIS PAGE TO A FRIEND

SWAP70

SWAP switching B-cell complex 70kDa subunit

Synonyms: SWAP-70
UniProtKB ID: Q9UH65, D3DQV1, O75135, Q7LCY6, Q9P061, Q9P0Z8
Gene ID:
Mouse(20947) SWA-70 protein
Rat(293410) SWAP switching B-cell complex 70
chicken(423044) SWAP switching B-cell complex 70kDa subunit
dog(485385) SWAP switching B-cell complex 70kDa subunit
domestic cat(101086597) SWAP switching B-cell complex 70kDa subunit
cow(533720) SWAP switching B-cell complex 70kDa subunit
sheep(101104007) SWAP switching B-cell complex 70kDa subunit
domestic guinea pig(100732365) SWAP switching B-cell complex 70kDa subunit
naked mole-rat(101704110) SWAP switching B-cell complex 70kDa subunit
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015055 Rosetta Predictions human pricing
NM_001106288 Rosetta Predictions rat pricing
NM_009302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109712 predicted 798
2 SASI_Hs01_00109713 predicted 1296
3 SASI_Hs01_00109715 predicted 701
4 SASI_Hs01_00109717 predicted 878
5 SASI_Hs02_00346904 predicted 707
6 SASI_Hs01_00109719 predicted 1549
7 SASI_Hs01_00109720 predicted 1001
8 SASI_Hs01_00109721 predicted 1061
9 SASI_Hs02_00346905 predicted 619
10 SASI_Hs01_00109714 predicted 690
11 SASI_Hs01_00109716 predicted 689
12 SASI_Hs01_00109718 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217498 predicted 436
2 SASI_Rn02_00217499 predicted 516
3 SASI_Rn02_00217500 predicted 758
4 SASI_Rn02_00217501 predicted 308
5 SASI_Rn02_00217502 predicted 523
6 SASI_Rn02_00217503 predicted 663
7 SASI_Rn02_00217504 predicted 905
8 SASI_Rn02_00217505 predicted 490
9 SASI_Rn02_00217506 predicted 1250
10 SASI_Rn02_00217507 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087580 predicted 1023
2 SASI_Mm01_00087581 predicted 576
3 SASI_Mm02_00315830 predicted 645
4 SASI_Mm01_00087582 predicted 947
5 SASI_Mm01_00087583 predicted 895
6 SASI_Mm01_00087584 predicted 752
7 SASI_Mm01_00087585 predicted 296
8 SASI_Mm01_00087586 predicted 505
9 SASI_Mm02_00315831 predicted 483
10 SASI_Mm01_00087587 predicted 424
11 SASI_Mm01_00087588 predicted 431
12 SASI_Mm01_00087589 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015055
VALIDATED
SWAP70 MISSION shRNA Bacterial Glycerol Stock
SWAP switching B-cell complex 70kDa subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015055.2-2318s21c1
Sequence:CCGGCCTAAGGAAGCCTTCTTATTTCTCGAGAAATAAGAAGGCTTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015055.2-894s21c1
Sequence:CCGGGCCTGACAAAGATGGAAAGAACTCGAGTTCTTTCCATCTTTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015055.2-297s21c1
Sequence:CCGGCCAGGGCTACATGCCTTATTTCTCGAGAAATAAGGCATGTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015055.2-1668s21c1
Sequence:CCGGGCTGGAGATGGCAACTAATAACTCGAGTTATTAGTTGCCATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-272s1c1
Sequence:CCGGCCAGGGCTACATGCCTTATTTCTCGAGAAATAAGGCATGTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-589s1c1
Sequence:CCGGGCCTTTCTGCATGGGAACTTACTCGAGTAAGTTCCCATGCAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-1767s1c1
Sequence:CCGGGCTTTCACTGAGGCAGAACTTCTCGAGAAGTTCTGCCTCAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-869s1c1
Sequence:CCGGGCCTGACAAAGATGGAAAGAACTCGAGTTCTTTCCATCTTTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-1689s1c1
Sequence:CCGGGCCCATCATGAAGGATTAATTCTCGAGAATTAATCCTTCATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015055
VALIDATED
SWAP70 MISSION shRNA shRNA Plasmid DNA
SWAP switching B-cell complex 70kDa subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015055.2-2318s21c1
Sequence:CCGGCCTAAGGAAGCCTTCTTATTTCTCGAGAAATAAGAAGGCTTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015055.2-894s21c1
Sequence:CCGGGCCTGACAAAGATGGAAAGAACTCGAGTTCTTTCCATCTTTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015055.2-297s21c1
Sequence:CCGGCCAGGGCTACATGCCTTATTTCTCGAGAAATAAGGCATGTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015055.2-1668s21c1
Sequence:CCGGGCTGGAGATGGCAACTAATAACTCGAGTTATTAGTTGCCATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-272s1c1
Sequence:CCGGCCAGGGCTACATGCCTTATTTCTCGAGAAATAAGGCATGTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-589s1c1
Sequence:CCGGGCCTTTCTGCATGGGAACTTACTCGAGTAAGTTCCCATGCAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-1767s1c1
Sequence:CCGGGCTTTCACTGAGGCAGAACTTCTCGAGAAGTTCTGCCTCAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-869s1c1
Sequence:CCGGGCCTGACAAAGATGGAAAGAACTCGAGTTCTTTCCATCTTTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-1689s1c1
Sequence:CCGGGCCCATCATGAAGGATTAATTCTCGAGAATTAATCCTTCATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015055
VALIDATED
SWAP70 MISSION shRNA Lentiviral Transduction Particles
SWAP switching B-cell complex 70kDa subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015055.2-2318s21c1
Sequence:CCGGCCTAAGGAAGCCTTCTTATTTCTCGAGAAATAAGAAGGCTTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015055.2-894s21c1
Sequence:CCGGGCCTGACAAAGATGGAAAGAACTCGAGTTCTTTCCATCTTTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015055.2-297s21c1
Sequence:CCGGCCAGGGCTACATGCCTTATTTCTCGAGAAATAAGGCATGTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015055.2-1668s21c1
Sequence:CCGGGCTGGAGATGGCAACTAATAACTCGAGTTATTAGTTGCCATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-272s1c1
Sequence:CCGGCCAGGGCTACATGCCTTATTTCTCGAGAAATAAGGCATGTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-589s1c1
Sequence:CCGGGCCTTTCTGCATGGGAACTTACTCGAGTAAGTTCCCATGCAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-1767s1c1
Sequence:CCGGGCTTTCACTGAGGCAGAACTTCTCGAGAAGTTCTGCCTCAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-869s1c1
Sequence:CCGGGCCTGACAAAGATGGAAAGAACTCGAGTTCTTTCCATCTTTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015055.1-1689s1c1
Sequence:CCGGGCCCATCATGAAGGATTAATTCTCGAGAATTAATCCTTCATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009302
VALIDATED
SWAP70 MISSION shRNA Bacterial Glycerol Stock
SWAP switching B-cell complex 70kDa subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009302.2-2982s1c1
Sequence:CCGGGCCTTCATACAGTTTAGATTTCTCGAGAAATCTAAACTGTATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-1665s1c1
Sequence:CCGGGCCCATCATGAGAGATTAATACTCGAGTATTAATCTCTCATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-369s1c1
Sequence:CCGGCCTCTACTCATTACAGAAGATCTCGAGATCTTCTGTAATGAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-689s1c1
Sequence:CCGGGCAGGGTTACATGATGAAGAACTCGAGTTCTTCATCATGTAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009302.2-756s1c1
Sequence:CCGGCCCAACATAATTTCCTACTATCTCGAGATAGTAGGAAATTATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009302
VALIDATED
SWAP70 MISSION shRNA shRNA Plasmid DNA
SWAP switching B-cell complex 70kDa subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009302.2-2982s1c1
Sequence:CCGGGCCTTCATACAGTTTAGATTTCTCGAGAAATCTAAACTGTATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-1665s1c1
Sequence:CCGGGCCCATCATGAGAGATTAATACTCGAGTATTAATCTCTCATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-369s1c1
Sequence:CCGGCCTCTACTCATTACAGAAGATCTCGAGATCTTCTGTAATGAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-689s1c1
Sequence:CCGGGCAGGGTTACATGATGAAGAACTCGAGTTCTTCATCATGTAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009302.2-756s1c1
Sequence:CCGGCCCAACATAATTTCCTACTATCTCGAGATAGTAGGAAATTATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009302
VALIDATED
SWAP70 MISSION shRNA Lentiviral Transduction Particles
SWAP switching B-cell complex 70kDa subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009302.2-2982s1c1
Sequence:CCGGGCCTTCATACAGTTTAGATTTCTCGAGAAATCTAAACTGTATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-1665s1c1
Sequence:CCGGGCCCATCATGAGAGATTAATACTCGAGTATTAATCTCTCATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-369s1c1
Sequence:CCGGCCTCTACTCATTACAGAAGATCTCGAGATCTTCTGTAATGAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009302.2-689s1c1
Sequence:CCGGGCAGGGTTACATGATGAAGAACTCGAGTTCTTCATCATGTAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009302.2-756s1c1
Sequence:CCGGCCCAACATAATTTCCTACTATCTCGAGATAGTAGGAAATTATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks