EMAIL THIS PAGE TO A FRIEND

SWI5

SWI5 recombination repair homolog (yeast)

Synonyms: C9orf119 bA395P17.9
UniProtKB ID: Q1ZZU3, Q5SYX7, Q5SYX8, Q8N2W6
Gene ID:
Mouse(72931) SWI5 recombination repair homolog (yeast)
Rat(499779) SWI5 recombination repair homolog (yeast)
Zebrafish(100333759) SWI5 recombination repair homolog (yeast)
domestic cat(101092805) SWI5 recombination repair homolog (yeast)
chicken(427767) SWI5 recombination repair homolog (yeast)
domestic guinea pig(100717096) SWI5 recombination repair homolog (yeast)
naked mole-rat(101701840) SWI5 recombination repair homolog (yeast)
cow(616324) SWI5 recombination repair homolog (yeast)
sheep(101120905) SWI5 recombination repair homolog (yeast)
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001040011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040011 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040011 Rosetta Predictions human pricing
XM_372143 Rosetta Predictions human pricing
XM_001079909 Rosetta Predictions rat pricing
XM_575112 Rosetta Predictions rat pricing
NM_175190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308750 predicted 534
2 SASI_Hs02_00308751 predicted 355
3 SASI_Hs02_00308752 predicted 651
4 SASI_Hs02_00308753 predicted 555
5 SASI_Hs02_00308754 predicted 368
6 SASI_Hs02_00308755 predicted 629
7 SASI_Hs02_00308756 predicted 521
8 SASI_Hs02_00308757 predicted 658
9 SASI_Hs02_00308758 predicted 376
10 SASI_Hs02_00308759 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248611 predicted 337
2 SASI_Hs01_00248612 predicted 260
3 SASI_Hs01_00248613 predicted 467
4 SASI_Hs01_00248614 predicted 364
5 SASI_Hs01_00248615 predicted 365
6 SASI_Hs01_00248616 predicted 470
7 SASI_Hs01_00248617 predicted 336
8 SASI_Hs01_00248618 predicted 332
9 SASI_Hs01_00248619 predicted 385
10 SASI_Hs01_00248620 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365944 predicted 255
2 SASI_Rn02_00365945 predicted 332
3 SASI_Rn02_00365946 predicted 261
4 SASI_Rn02_00365947 predicted 334
5 SASI_Rn02_00365948 predicted 314
6 SASI_Rn02_00365949 predicted 256
7 SASI_Rn02_00365950 predicted 486
8 SASI_Rn02_00365951 predicted 444
9 SASI_Rn02_00365952 predicted 489
10 SASI_Rn02_00365953 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403085 predicted 331
2 SASI_Rn02_00403086 predicted 255
3 SASI_Rn02_00403087 predicted 254
4 SASI_Rn02_00403088 predicted 330
5 SASI_Rn02_00403089 predicted 476
6 SASI_Rn02_00403090 predicted 321
7 SASI_Rn02_00403091 predicted 493
8 SASI_Rn02_00403092 predicted 444
9 SASI_Rn02_00403093 predicted 484
10 SASI_Rn02_00403094 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168131 predicted 297
2 SASI_Mm02_00345852 predicted 463
3 SASI_Mm01_00168132 predicted 287
4 SASI_Mm01_00168133 predicted 465
5 SASI_Mm01_00168134 predicted 376
6 SASI_Mm01_00168135 predicted 421
7 SASI_Mm01_00168136 predicted 291
8 SASI_Mm01_00168137 predicted 406
9 SASI_Mm01_00168138 predicted 371
10 SASI_Mm01_00168139 predicted 357
11 SASI_Mm01_00168140 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175190
VALIDATED
SWI5 MISSION shRNA Bacterial Glycerol Stock
SWI5 recombination repair homolog (yeast)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-539s1c1
Sequence:CCGGGCAGAGTCTAGACAGTATGTTCTCGAGAACATACTGTCTAGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-544s1c1
Sequence:CCGGGTCTAGACAGTATGTTCATATCTCGAGATATGAACATACTGTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-427s1c1
Sequence:CCGGCGTTACCACCAAGGAGTTATACTCGAGTATAACTCCTTGGTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-249s1c1
Sequence:CCGGGCTCTGACATTAAGAAACTGACTCGAGTCAGTTTCTTAATGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175190
VALIDATED
SWI5 MISSION shRNA shRNA Plasmid DNA
SWI5 recombination repair homolog (yeast)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-539s1c1
Sequence:CCGGGCAGAGTCTAGACAGTATGTTCTCGAGAACATACTGTCTAGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-544s1c1
Sequence:CCGGGTCTAGACAGTATGTTCATATCTCGAGATATGAACATACTGTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-427s1c1
Sequence:CCGGCGTTACCACCAAGGAGTTATACTCGAGTATAACTCCTTGGTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-249s1c1
Sequence:CCGGGCTCTGACATTAAGAAACTGACTCGAGTCAGTTTCTTAATGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175190
VALIDATED
SWI5 MISSION shRNA Lentiviral Transduction Particles
SWI5 recombination repair homolog (yeast)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-539s1c1
Sequence:CCGGGCAGAGTCTAGACAGTATGTTCTCGAGAACATACTGTCTAGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-544s1c1
Sequence:CCGGGTCTAGACAGTATGTTCATATCTCGAGATATGAACATACTGTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-427s1c1
Sequence:CCGGCGTTACCACCAAGGAGTTATACTCGAGTATAACTCCTTGGTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175190.2-249s1c1
Sequence:CCGGGCTCTGACATTAAGAAACTGACTCGAGTCAGTTTCTTAATGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040011
VALIDATED
SWI5 MISSION shRNA Bacterial Glycerol Stock
SWI5 recombination repair homolog (yeast)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-746s21c1
Sequence:CCGGAGAAGGGTGTGGACATGATAACTCGAGTTATCATGTCCACACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040011.1-525s21c1
Sequence:CCGGGGAGATCTCCCAGTTCGTATCCTCGAGGATACGAACTGGGAGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-375s21c1
Sequence:CCGGTAGGACTGAACCAAGACTTACCTCGAGGTAAGTCTTGGTTCAGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-584s21c1
Sequence:CCGGCCCAGCTTCACGAGTACAATGCTCGAGCATTGTACTCGTGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040011.1-338s21c1
Sequence:CCGGTGTGGGTCCAATCAGACTTTCCTCGAGGAAAGTCTGATTGGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040011
VALIDATED
SWI5 MISSION shRNA shRNA Plasmid DNA
SWI5 recombination repair homolog (yeast)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-746s21c1
Sequence:CCGGAGAAGGGTGTGGACATGATAACTCGAGTTATCATGTCCACACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040011.1-525s21c1
Sequence:CCGGGGAGATCTCCCAGTTCGTATCCTCGAGGATACGAACTGGGAGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-375s21c1
Sequence:CCGGTAGGACTGAACCAAGACTTACCTCGAGGTAAGTCTTGGTTCAGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-584s21c1
Sequence:CCGGCCCAGCTTCACGAGTACAATGCTCGAGCATTGTACTCGTGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040011.1-338s21c1
Sequence:CCGGTGTGGGTCCAATCAGACTTTCCTCGAGGAAAGTCTGATTGGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040011
VALIDATED
SWI5 MISSION shRNA Lentiviral Transduction Particles
SWI5 recombination repair homolog (yeast)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-746s21c1
Sequence:CCGGAGAAGGGTGTGGACATGATAACTCGAGTTATCATGTCCACACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040011.1-525s21c1
Sequence:CCGGGGAGATCTCCCAGTTCGTATCCTCGAGGATACGAACTGGGAGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-375s21c1
Sequence:CCGGTAGGACTGAACCAAGACTTACCTCGAGGTAAGTCTTGGTTCAGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040011.1-584s21c1
Sequence:CCGGCCCAGCTTCACGAGTACAATGCTCGAGCATTGTACTCGTGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040011.1-338s21c1
Sequence:CCGGTGTGGGTCCAATCAGACTTTCCTCGAGGAAAGTCTGATTGGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks