EMAIL THIS PAGE TO A FRIEND

SWSAP1

SWIM-type zinc finger 7 associated protein 1

Synonyms: C19orf39 SWS1AP1 ZSWIM7AP1
UniProtKB ID: Q6NVH7, Q8NAM1
Gene ID:
Mouse(66962) SWIM type zinc finger 7 associated protein 1
Rat(363029) SWIM-type zinc finger 7 associated protein 1
Zebrafish(568383) SWIM-type zinc finger 7 associated protein 1
domestic cat(101098694) SWIM-type zinc finger 7 associated protein 1
dog(611130) SWIM-type zinc finger 7 associated protein 1
cow(507152) SWIM-type zinc finger 7 associated protein 1
sheep(101119042) SWIM-type zinc finger 7 associated protein 1
naked mole-rat(101710304) SWIM-type zinc finger 7 associated protein 1
domestic guinea pig(100725608) SWIM-type zinc finger 7 associated protein 1
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175871 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175871 Rosetta Predictions human pricing
NM_001108755 Rosetta Predictions rat pricing
XM_150151 Rosetta Predictions mouse pricing
XM_913186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238755 predicted 369
2 SASI_Hs01_00238757 predicted 428
3 SASI_Hs01_00238758 predicted 494
4 SASI_Hs01_00238759 predicted 317
5 SASI_Hs01_00238761 predicted 439
6 SASI_Hs01_00238762 predicted 396
7 SASI_Hs02_00369145 predicted 493
8 SASI_Hs01_00238763 predicted 241
9 SASI_Hs02_00369146 predicted 233
10 SASI_Hs01_00238764 predicted 327
11 SASI_Hs01_00238756 predicted 372
12 SASI_Hs01_00238760 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241765 predicted 909
2 SASI_Rn02_00241766 predicted 1074
3 SASI_Rn02_00241767 predicted 466
4 SASI_Rn02_00241768 predicted 1174
5 SASI_Rn02_00241769 predicted 849
6 SASI_Rn02_00241770 predicted 307
7 SASI_Rn02_00241771 predicted 1180
8 SASI_Rn02_00241772 predicted 586
9 SASI_Rn02_00241773 predicted 907
10 SASI_Rn02_00241774 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_150151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425379 predicted 790
2 SASI_Mm01_00206537 predicted 853
3 SASI_Mm02_00425380 predicted 844
4 SASI_Mm02_00425381 predicted 906
5 SASI_Mm02_00425382 predicted 553
6 SASI_Mm02_00425383 predicted 783
7 SASI_Mm02_00425384 predicted 729
8 SASI_Mm02_00425385 predicted 593
9 SASI_Mm01_00206541 predicted 1076
10 SASI_Mm02_00425386 predicted 967
11 SASI_Mm01_00206534 predicted 395
12 SASI_Mm01_00206535 predicted 1015
13 SASI_Mm01_00206536 predicted 1033
14 SASI_Mm01_00206538 predicted 620
15 SASI_Mm01_00206539 predicted 1114
16 SASI_Mm01_00206540 predicted 752
17 SASI_Mm01_00206542 predicted 1092
18 SASI_Mm01_00206543 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437545 predicted 846
2 SASI_Mm02_00437546 predicted 1432
3 SASI_Mm02_00437547 predicted 1420
4 SASI_Mm02_00437548 predicted 1419
5 SASI_Mm02_00437549 predicted 1435
6 SASI_Mm02_00437550 predicted 1043
7 SASI_Mm02_00437551 predicted 723
8 SASI_Mm02_00437552 predicted 1345
9 SASI_Mm02_00437553 predicted 1357
10 SASI_Mm02_00437554 predicted 1076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025870
VALIDATED
SWSAP1 MISSION shRNA Bacterial Glycerol Stock
SWIM-type zinc finger 7 associated protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-262s21c1
Sequence:CCGGTTCCAGTACCCATCCTCAATTCTCGAGAATTGAGGATGGGTACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025870.1-907s21c1
Sequence:CCGGTGGCAACAGGCACGGTAATTTCTCGAGAAATTACCGTGCCTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-795s21c1
Sequence:CCGGTCCCTTGGATGGGATACTTACCTCGAGGTAAGTATCCCATCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-474s21c1
Sequence:CCGGGCTTGTTGTGGCCCTTGAAACCTCGAGGTTTCAAGGGCCACAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025870.1-422s21c1
Sequence:CCGGTGGATACTGCTGCCTTCTTTACTCGAGTAAAGAAGGCAGCAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-1274s21c1
Sequence:CCGGCTTGGCTCCTCTTGCACATTCCTCGAGGAATGTGCAAGAGGAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-528s21c1
Sequence:CCGGGCCATTACTTAAGCGATATTTCTCGAGAAATATCGCTTAAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025870
VALIDATED
SWSAP1 MISSION shRNA shRNA Plasmid DNA
SWIM-type zinc finger 7 associated protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-262s21c1
Sequence:CCGGTTCCAGTACCCATCCTCAATTCTCGAGAATTGAGGATGGGTACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025870.1-907s21c1
Sequence:CCGGTGGCAACAGGCACGGTAATTTCTCGAGAAATTACCGTGCCTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-795s21c1
Sequence:CCGGTCCCTTGGATGGGATACTTACCTCGAGGTAAGTATCCCATCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-474s21c1
Sequence:CCGGGCTTGTTGTGGCCCTTGAAACCTCGAGGTTTCAAGGGCCACAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025870.1-422s21c1
Sequence:CCGGTGGATACTGCTGCCTTCTTTACTCGAGTAAAGAAGGCAGCAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-1274s21c1
Sequence:CCGGCTTGGCTCCTCTTGCACATTCCTCGAGGAATGTGCAAGAGGAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-528s21c1
Sequence:CCGGGCCATTACTTAAGCGATATTTCTCGAGAAATATCGCTTAAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025870
VALIDATED
SWSAP1 MISSION shRNA Lentiviral Transduction Particles
SWIM-type zinc finger 7 associated protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-262s21c1
Sequence:CCGGTTCCAGTACCCATCCTCAATTCTCGAGAATTGAGGATGGGTACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025870.1-907s21c1
Sequence:CCGGTGGCAACAGGCACGGTAATTTCTCGAGAAATTACCGTGCCTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-795s21c1
Sequence:CCGGTCCCTTGGATGGGATACTTACCTCGAGGTAAGTATCCCATCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-474s21c1
Sequence:CCGGGCTTGTTGTGGCCCTTGAAACCTCGAGGTTTCAAGGGCCACAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025870.1-422s21c1
Sequence:CCGGTGGATACTGCTGCCTTCTTTACTCGAGTAAAGAAGGCAGCAGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-1274s21c1
Sequence:CCGGCTTGGCTCCTCTTGCACATTCCTCGAGGAATGTGCAAGAGGAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025870.1-528s21c1
Sequence:CCGGGCCATTACTTAAGCGATATTTCTCGAGAAATATCGCTTAAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175871
VALIDATED
SWSAP1 MISSION shRNA Bacterial Glycerol Stock
SWIM-type zinc finger 7 associated protein 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175871.3-803s21c1
Sequence:CCGGCCAAAGACCTAAACAATGTAACTCGAGTTACATTGTTTAGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-194s21c1
Sequence:CCGGGGAACGACTCTAGACCCAATGCTCGAGCATTGGGTCTAGAGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-636s21c1
Sequence:CCGGGATCAGATGGAGAAATGATGACTCGAGTCATCATTTCTCCATCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-157s21c1
Sequence:CCGGGACACGAAGGCCTCTTCAAAGCTCGAGCTTTGAAGAGGCCTTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-502s21c1
Sequence:CCGGGGCACTGCTCCAGCGGTATTTCTCGAGAAATACCGCTGGAGCAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-329s1c1
Sequence:CCGGCTAGAAGAGTACCTAGCGGAACTCGAGTTCCGCTAGGTACTCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-645s1c1
Sequence:CCGGGAGAAATGATGATCGCTCCGTCTCGAGACGGAGCGATCATCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175871.2-803s1c1
Sequence:CCGGCCAAAGACCTAAACAATGTAACTCGAGTTACATTGTTTAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1349s1c1
Sequence:CCGGCTTCATCAGATTGCCTTATTTCTCGAGAAATAAGGCAATCTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175871.2-810s1c1
Sequence:CCGGCCTAAACAATGTAAAGTGCTTCTCGAGAAGCACTTTACATTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1022s1c1
Sequence:CCGGCCAACATGATGAAACCCTGTACTCGAGTACAGGGTTTCATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-636s1c1
Sequence:CCGGGATCAGATGGAGAAATGATGACTCGAGTCATCATTTCTCCATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1023s1c1
Sequence:CCGGCAACATGATGAAACCCTGTATCTCGAGATACAGGGTTTCATCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-634s1c1
Sequence:CCGGCCGATCAGATGGAGAAATGATCTCGAGATCATTTCTCCATCTGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-373s1c1
Sequence:CCGGCTGCCTCATTGCCTTACTTCTCTCGAGAGAAGTAAGGCAATGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175871
VALIDATED
SWSAP1 MISSION shRNA shRNA Plasmid DNA
SWIM-type zinc finger 7 associated protein 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175871.3-803s21c1
Sequence:CCGGCCAAAGACCTAAACAATGTAACTCGAGTTACATTGTTTAGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-194s21c1
Sequence:CCGGGGAACGACTCTAGACCCAATGCTCGAGCATTGGGTCTAGAGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-636s21c1
Sequence:CCGGGATCAGATGGAGAAATGATGACTCGAGTCATCATTTCTCCATCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-157s21c1
Sequence:CCGGGACACGAAGGCCTCTTCAAAGCTCGAGCTTTGAAGAGGCCTTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-502s21c1
Sequence:CCGGGGCACTGCTCCAGCGGTATTTCTCGAGAAATACCGCTGGAGCAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-329s1c1
Sequence:CCGGCTAGAAGAGTACCTAGCGGAACTCGAGTTCCGCTAGGTACTCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-645s1c1
Sequence:CCGGGAGAAATGATGATCGCTCCGTCTCGAGACGGAGCGATCATCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175871.2-803s1c1
Sequence:CCGGCCAAAGACCTAAACAATGTAACTCGAGTTACATTGTTTAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1349s1c1
Sequence:CCGGCTTCATCAGATTGCCTTATTTCTCGAGAAATAAGGCAATCTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175871.2-810s1c1
Sequence:CCGGCCTAAACAATGTAAAGTGCTTCTCGAGAAGCACTTTACATTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1022s1c1
Sequence:CCGGCCAACATGATGAAACCCTGTACTCGAGTACAGGGTTTCATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-636s1c1
Sequence:CCGGGATCAGATGGAGAAATGATGACTCGAGTCATCATTTCTCCATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1023s1c1
Sequence:CCGGCAACATGATGAAACCCTGTATCTCGAGATACAGGGTTTCATCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-634s1c1
Sequence:CCGGCCGATCAGATGGAGAAATGATCTCGAGATCATTTCTCCATCTGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-373s1c1
Sequence:CCGGCTGCCTCATTGCCTTACTTCTCTCGAGAGAAGTAAGGCAATGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175871
VALIDATED
SWSAP1 MISSION shRNA Lentiviral Transduction Particles
SWIM-type zinc finger 7 associated protein 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175871.3-803s21c1
Sequence:CCGGCCAAAGACCTAAACAATGTAACTCGAGTTACATTGTTTAGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-194s21c1
Sequence:CCGGGGAACGACTCTAGACCCAATGCTCGAGCATTGGGTCTAGAGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-636s21c1
Sequence:CCGGGATCAGATGGAGAAATGATGACTCGAGTCATCATTTCTCCATCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-157s21c1
Sequence:CCGGGACACGAAGGCCTCTTCAAAGCTCGAGCTTTGAAGAGGCCTTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175871.3-502s21c1
Sequence:CCGGGGCACTGCTCCAGCGGTATTTCTCGAGAAATACCGCTGGAGCAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-329s1c1
Sequence:CCGGCTAGAAGAGTACCTAGCGGAACTCGAGTTCCGCTAGGTACTCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-645s1c1
Sequence:CCGGGAGAAATGATGATCGCTCCGTCTCGAGACGGAGCGATCATCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175871.2-803s1c1
Sequence:CCGGCCAAAGACCTAAACAATGTAACTCGAGTTACATTGTTTAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1349s1c1
Sequence:CCGGCTTCATCAGATTGCCTTATTTCTCGAGAAATAAGGCAATCTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175871.2-810s1c1
Sequence:CCGGCCTAAACAATGTAAAGTGCTTCTCGAGAAGCACTTTACATTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1022s1c1
Sequence:CCGGCCAACATGATGAAACCCTGTACTCGAGTACAGGGTTTCATCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-636s1c1
Sequence:CCGGGATCAGATGGAGAAATGATGACTCGAGTCATCATTTCTCCATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175871.2-1023s1c1
Sequence:CCGGCAACATGATGAAACCCTGTATCTCGAGATACAGGGTTTCATCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-634s1c1
Sequence:CCGGCCGATCAGATGGAGAAATGATCTCGAGATCATTTCTCCATCTGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175871.2-373s1c1
Sequence:CCGGCTGCCTCATTGCCTTACTTCTCTCGAGAGAAGTAAGGCAATGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks