EMAIL THIS PAGE TO A FRIEND

SWT1

SWT1 RNA endoribonuclease homolog (S. cerevisiae)

Synonyms: C1orf26 HsSwt1
UniProtKB ID: Q5T5J6, Q8NEK9, Q9BZQ7, Q9NXQ0
Gene ID:
Mouse(66875) SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Rat(289088) Swt1 RNA endoribonuclease homolog (S. cerevisiae)
Zebrafish(559432) SWT1 RNA endoribonuclease homolog (S. cerevisiae)
dog(490316) SWT1 RNA endoribonuclease homolog (S. cerevisiae)
chicken(100859817) SWT1 RNA endoribonuclease homolog (S. cerevisiae)
cow(506599) SWT1 RNA endoribonuclease homolog (S. cerevisiae)
sheep(101123224) SWT1 RNA endoribonuclease homolog (S. cerevisiae)
domestic guinea pig(100717392) SWT1 RNA endoribonuclease homolog (S. cerevisiae)
naked mole-rat(101698938) SWT1 RNA endoribonuclease homolog (S. cerevisiae)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017673 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105518 Rosetta Predictions human pricing
NM_017673 Rosetta Predictions human pricing
NM_001105960 Rosetta Predictions rat pricing
NM_025819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324159 predicted 1182
2 SASI_Hs02_00324160 predicted 1801
3 SASI_Hs02_00324161 predicted 563
4 SASI_Hs02_00324162 predicted 1215
5 SASI_Hs02_00324163 predicted 2081
6 SASI_Hs02_00324164 predicted 405
7 SASI_Hs02_00324165 predicted 2142
8 SASI_Hs02_00324166 predicted 1733
9 SASI_Hs02_00324167 predicted 2787
10 SASI_Hs02_00324168 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165298 predicted 1230
2 SASI_Hs02_00350406 predicted 1851
3 SASI_Hs02_00350407 predicted 609
4 SASI_Hs01_00165299 predicted 1272
5 SASI_Hs01_00165300 predicted 2135
6 SASI_Hs01_00165302 predicted 456
7 SASI_Hs01_00165303 predicted 2192
8 SASI_Hs02_00350408 predicted 1792
9 SASI_Hs01_00165305 predicted 2839
10 SASI_Hs01_00165304 predicted 1743
11 SASI_Hs01_00165301 predicted 1902
12 SASI_Hs01_00165306 predicted 2134
13 SASI_Hs01_00165307 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214242 predicted 2120
2 SASI_Rn02_00214243 predicted 584
3 SASI_Rn02_00214244 predicted 1261
4 SASI_Rn02_00214245 predicted 1408
5 SASI_Rn02_00214246 predicted 340
6 SASI_Rn02_00214247 predicted 2691
7 SASI_Rn02_00214248 predicted 2158
8 SASI_Rn02_00214249 predicted 1455
9 SASI_Rn02_00214250 predicted 224
10 SASI_Rn02_00214251 predicted 2404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046027 predicted 2045
2 SASI_Mm01_00046028 predicted 488
3 SASI_Mm01_00046029 predicted 285
4 SASI_Mm01_00046030 predicted 2623
5 SASI_Mm02_00329068 predicted 790
6 SASI_Mm01_00046031 predicted 1390
7 SASI_Mm01_00046032 predicted 2592
8 SASI_Mm01_00046035 predicted 1865
9 SASI_Mm02_00329069 predicted 1772
10 SASI_Mm01_00046036 predicted 731
11 SASI_Mm01_00046033 predicted 2558
12 SASI_Mm01_00046034 predicted 2466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025819
VALIDATED
SWT1 MISSION shRNA Bacterial Glycerol Stock
SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2227s1c1
Sequence:CCGGCCCAGACCTTTGCTCAAGTAACTCGAGTTACTTGAGCAAAGGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025819.2-1890s1c1
Sequence:CCGGCGGATCATTTGTGATCTTGAACTCGAGTTCAAGATCACAAATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-1672s1c1
Sequence:CCGGGCACGGATGATAGAAATTTAACTCGAGTTAAATTTCTATCATCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-511s1c1
Sequence:CCGGGTTGTTCATCAAATGGAACTACTCGAGTAGTTCCATTTGATGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-361s1c1
Sequence:CCGGCAGATGATACAGACAATGTATCTCGAGATACATTGTCTGTATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-1063s1c1
Sequence:CCGGGAACGAGTAGTTCCGATTCTACTCGAGTAGAATCGGAACTACTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2645s1c1
Sequence:CCGGCCTAATCAAGTATGAGGTAAACTCGAGTTTACCTCATACTTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2688s1c1
Sequence:CCGGCGGGAACTTTATGATTGTGTTCTCGAGAACACAATCATAAAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025819.3-2993s1c1
Sequence:CCGGCATTGAATCTAGTGTAGTATACTCGAGTATACTACACTAGATTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025819.3-3236s1c1
Sequence:CCGGCATGAACAAACTGTCATTTATCTCGAGATAAATGACAGTTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025819
VALIDATED
SWT1 MISSION shRNA shRNA Plasmid DNA
SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2227s1c1
Sequence:CCGGCCCAGACCTTTGCTCAAGTAACTCGAGTTACTTGAGCAAAGGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025819.2-1890s1c1
Sequence:CCGGCGGATCATTTGTGATCTTGAACTCGAGTTCAAGATCACAAATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-1672s1c1
Sequence:CCGGGCACGGATGATAGAAATTTAACTCGAGTTAAATTTCTATCATCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-511s1c1
Sequence:CCGGGTTGTTCATCAAATGGAACTACTCGAGTAGTTCCATTTGATGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-361s1c1
Sequence:CCGGCAGATGATACAGACAATGTATCTCGAGATACATTGTCTGTATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-1063s1c1
Sequence:CCGGGAACGAGTAGTTCCGATTCTACTCGAGTAGAATCGGAACTACTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2645s1c1
Sequence:CCGGCCTAATCAAGTATGAGGTAAACTCGAGTTTACCTCATACTTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2688s1c1
Sequence:CCGGCGGGAACTTTATGATTGTGTTCTCGAGAACACAATCATAAAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025819.3-2993s1c1
Sequence:CCGGCATTGAATCTAGTGTAGTATACTCGAGTATACTACACTAGATTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025819.3-3236s1c1
Sequence:CCGGCATGAACAAACTGTCATTTATCTCGAGATAAATGACAGTTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025819
VALIDATED
SWT1 MISSION shRNA Lentiviral Transduction Particles
SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2227s1c1
Sequence:CCGGCCCAGACCTTTGCTCAAGTAACTCGAGTTACTTGAGCAAAGGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025819.2-1890s1c1
Sequence:CCGGCGGATCATTTGTGATCTTGAACTCGAGTTCAAGATCACAAATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-1672s1c1
Sequence:CCGGGCACGGATGATAGAAATTTAACTCGAGTTAAATTTCTATCATCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-511s1c1
Sequence:CCGGGTTGTTCATCAAATGGAACTACTCGAGTAGTTCCATTTGATGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-361s1c1
Sequence:CCGGCAGATGATACAGACAATGTATCTCGAGATACATTGTCTGTATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025819.2-1063s1c1
Sequence:CCGGGAACGAGTAGTTCCGATTCTACTCGAGTAGAATCGGAACTACTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2645s1c1
Sequence:CCGGCCTAATCAAGTATGAGGTAAACTCGAGTTTACCTCATACTTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025819.2-2688s1c1
Sequence:CCGGCGGGAACTTTATGATTGTGTTCTCGAGAACACAATCATAAAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025819.3-2993s1c1
Sequence:CCGGCATTGAATCTAGTGTAGTATACTCGAGTATACTACACTAGATTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025819.3-3236s1c1
Sequence:CCGGCATGAACAAACTGTCATTTATCTCGAGATAAATGACAGTTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017673
SWT1 MISSION shRNA Bacterial Glycerol Stock
SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017673.4-3200s1c1
Sequence:CCGGCCCAGGGTACAGTATTAGCATCTCGAGATGCTAATACTGTACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-1182s1c1
Sequence:CCGGGCAGATCAAGAGATGCAGATACTCGAGTATCTGCATCTCTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017673.4-1185s1c1
Sequence:CCGGGATCAAGAGATGCAGATAGTACTCGAGTACTATCTGCATCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-2420s1c1
Sequence:CCGGGCATCAAGAAATCTGGTCTATCTCGAGATAGACCAGATTTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017673.4-3002s1c1
Sequence:CCGGGCCTATTACTGACAGTCTCATCTCGAGATGAGACTGTCAGTAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-1050s1c1
Sequence:CCGGCGGACTGTTCATGAGTGGAAACTCGAGTTTCCACTCATGAACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-2848s21c1
Sequence:CCGGATGCTCAACTATAGGATATAACTCGAGTTATATCCTATAGTTGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-2064s21c1
Sequence:CCGGGGCTGTATTTGGATTAGTTATCTCGAGATAACTAATCCAAATACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-343s21c1
Sequence:CCGGACAGATGTTCTGTACTATAATCTCGAGATTATAGTACAGAACATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017673
SWT1 MISSION shRNA shRNA Plasmid DNA
SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017673.4-3200s1c1
Sequence:CCGGCCCAGGGTACAGTATTAGCATCTCGAGATGCTAATACTGTACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-1182s1c1
Sequence:CCGGGCAGATCAAGAGATGCAGATACTCGAGTATCTGCATCTCTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017673.4-1185s1c1
Sequence:CCGGGATCAAGAGATGCAGATAGTACTCGAGTACTATCTGCATCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-2420s1c1
Sequence:CCGGGCATCAAGAAATCTGGTCTATCTCGAGATAGACCAGATTTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017673.4-3002s1c1
Sequence:CCGGGCCTATTACTGACAGTCTCATCTCGAGATGAGACTGTCAGTAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-1050s1c1
Sequence:CCGGCGGACTGTTCATGAGTGGAAACTCGAGTTTCCACTCATGAACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-2848s21c1
Sequence:CCGGATGCTCAACTATAGGATATAACTCGAGTTATATCCTATAGTTGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-2064s21c1
Sequence:CCGGGGCTGTATTTGGATTAGTTATCTCGAGATAACTAATCCAAATACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-343s21c1
Sequence:CCGGACAGATGTTCTGTACTATAATCTCGAGATTATAGTACAGAACATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017673
SWT1 MISSION shRNA Lentiviral Transduction Particles
SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017673.4-3200s1c1
Sequence:CCGGCCCAGGGTACAGTATTAGCATCTCGAGATGCTAATACTGTACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-1182s1c1
Sequence:CCGGGCAGATCAAGAGATGCAGATACTCGAGTATCTGCATCTCTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017673.4-1185s1c1
Sequence:CCGGGATCAAGAGATGCAGATAGTACTCGAGTACTATCTGCATCTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-2420s1c1
Sequence:CCGGGCATCAAGAAATCTGGTCTATCTCGAGATAGACCAGATTTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017673.4-3002s1c1
Sequence:CCGGGCCTATTACTGACAGTCTCATCTCGAGATGAGACTGTCAGTAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017673.4-1050s1c1
Sequence:CCGGCGGACTGTTCATGAGTGGAAACTCGAGTTTCCACTCATGAACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-2848s21c1
Sequence:CCGGATGCTCAACTATAGGATATAACTCGAGTTATATCCTATAGTTGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-2064s21c1
Sequence:CCGGGGCTGTATTTGGATTAGTTATCTCGAGATAACTAATCCAAATACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017673.6-343s21c1
Sequence:CCGGACAGATGTTCTGTACTATAATCTCGAGATTATAGTACAGAACATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks