EMAIL THIS PAGE TO A FRIEND

SYAP1

synapse associated protein 1

UniProtKB ID: Q96A49, Q68CP1, Q96C60, Q96JQ6, Q96T20
Gene ID:
Mouse(67043) synapse associated protein 1
Rat(302678) synapse associated protein 1
cow(509355) synapse associated protein 1
sheep(101106142) synapse associated protein 1
naked mole-rat(101705879) synapse associated protein 1
domestic guinea pig(100719383) synapse associated protein 1
Zebrafish(393916) synapse associated protein 1
chicken(418619) synapse associated protein 1
domestic cat(101097702) synapse associated protein 1
dog(480852) synapse associated protein 1
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032796 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU027841 MISSION® esiRNA esiRNA targeting mouse Syap1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032796 Rosetta Predictions human pricing
NM_001004253 Rosetta Predictions rat pricing
NM_025932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243927 predicted 564
2 SASI_Hs01_00243928 predicted 341
3 SASI_Hs01_00243929 predicted 677
4 SASI_Hs01_00243930 predicted 932
5 SASI_Hs01_00243931 predicted 317
6 SASI_Hs01_00243932 predicted 1191
7 SASI_Hs01_00243933 predicted 474
8 SASI_Hs01_00243934 predicted 519
9 SASI_Hs01_00243935 predicted 1187
10 SASI_Hs02_00360356 predicted 1213
11 SASI_Hs01_00243936 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118454 predicted 357
2 SASI_Rn01_00118455 predicted 784
3 SASI_Rn01_00118456 predicted 1110
4 SASI_Rn01_00118457 predicted 656
5 SASI_Rn01_00118458 predicted 398
6 SASI_Rn01_00118459 predicted 1017
7 SASI_Rn01_00118460 predicted 390
8 SASI_Rn02_00198272 predicted 933
9 SASI_Rn01_00118461 predicted 733
10 SASI_Rn01_00118462 predicted 599
11 SASI_Rn01_00118463 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329319 predicted 1063
2 SASI_Mm01_00059290 predicted 731
3 SASI_Mm01_00059292 predicted 655
4 SASI_Mm01_00059293 predicted 356
5 SASI_Mm01_00059294 predicted 797
6 SASI_Mm01_00059295 predicted 385
7 SASI_Mm01_00059296 predicted 719
8 SASI_Mm01_00059297 predicted 966
9 SASI_Mm01_00059299 predicted 461
10 SASI_Mm02_00329320 predicted 1031
11 SASI_Mm01_00059291 predicted 608
12 SASI_Mm01_00059298 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025932
VALIDATED
SYAP1 MISSION shRNA Bacterial Glycerol Stock
synapse associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1515s21c1
Sequence:CCGGCTAGAAGGTTGGCAACATAATCTCGAGATTATGTTGCCAACCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1023s21c1
Sequence:CCGGGCCTTCGATACGTGCAGCTTACTCGAGTAAGCTGCACGTATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1036s21c1
Sequence:CCGGGCAGCTTAAATCAGGAGGATTCTCGAGAATCCTCCTGATTTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025932.1-654s21c1
Sequence:CCGGGCTGGTGTGCAGTTTAACTTTCTCGAGAAAGTTAAACTGCACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-390s21c1
Sequence:CCGGGCAACAAAGAAGATAACTGAACTCGAGTTCAGTTATCTTCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1373s1c1
Sequence:CCGGGCCTCTTAAATGAACAGCTATCTCGAGATAGCTGTTCATTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1036s1c1
Sequence:CCGGGCAGCTTAAATCAGGAGGATTCTCGAGAATCCTCCTGATTTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-390s1c1
Sequence:CCGGGCAACAAAGAAGATAACTGAACTCGAGTTCAGTTATCTTCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025932.1-654s1c1
Sequence:CCGGGCTGGTGTGCAGTTTAACTTTCTCGAGAAAGTTAAACTGCACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1023s1c1
Sequence:CCGGGCCTTCGATACGTGCAGCTTACTCGAGTAAGCTGCACGTATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025932
VALIDATED
SYAP1 MISSION shRNA shRNA Plasmid DNA
synapse associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1515s21c1
Sequence:CCGGCTAGAAGGTTGGCAACATAATCTCGAGATTATGTTGCCAACCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1023s21c1
Sequence:CCGGGCCTTCGATACGTGCAGCTTACTCGAGTAAGCTGCACGTATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1036s21c1
Sequence:CCGGGCAGCTTAAATCAGGAGGATTCTCGAGAATCCTCCTGATTTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025932.1-654s21c1
Sequence:CCGGGCTGGTGTGCAGTTTAACTTTCTCGAGAAAGTTAAACTGCACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-390s21c1
Sequence:CCGGGCAACAAAGAAGATAACTGAACTCGAGTTCAGTTATCTTCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1373s1c1
Sequence:CCGGGCCTCTTAAATGAACAGCTATCTCGAGATAGCTGTTCATTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1036s1c1
Sequence:CCGGGCAGCTTAAATCAGGAGGATTCTCGAGAATCCTCCTGATTTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-390s1c1
Sequence:CCGGGCAACAAAGAAGATAACTGAACTCGAGTTCAGTTATCTTCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025932.1-654s1c1
Sequence:CCGGGCTGGTGTGCAGTTTAACTTTCTCGAGAAAGTTAAACTGCACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1023s1c1
Sequence:CCGGGCCTTCGATACGTGCAGCTTACTCGAGTAAGCTGCACGTATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025932
VALIDATED
SYAP1 MISSION shRNA Lentiviral Transduction Particles
synapse associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1515s21c1
Sequence:CCGGCTAGAAGGTTGGCAACATAATCTCGAGATTATGTTGCCAACCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1023s21c1
Sequence:CCGGGCCTTCGATACGTGCAGCTTACTCGAGTAAGCTGCACGTATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-1036s21c1
Sequence:CCGGGCAGCTTAAATCAGGAGGATTCTCGAGAATCCTCCTGATTTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025932.1-654s21c1
Sequence:CCGGGCTGGTGTGCAGTTTAACTTTCTCGAGAAAGTTAAACTGCACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025932.1-390s21c1
Sequence:CCGGGCAACAAAGAAGATAACTGAACTCGAGTTCAGTTATCTTCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1373s1c1
Sequence:CCGGGCCTCTTAAATGAACAGCTATCTCGAGATAGCTGTTCATTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1036s1c1
Sequence:CCGGGCAGCTTAAATCAGGAGGATTCTCGAGAATCCTCCTGATTTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-390s1c1
Sequence:CCGGGCAACAAAGAAGATAACTGAACTCGAGTTCAGTTATCTTCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025932.1-654s1c1
Sequence:CCGGGCTGGTGTGCAGTTTAACTTTCTCGAGAAAGTTAAACTGCACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025932.1-1023s1c1
Sequence:CCGGGCCTTCGATACGTGCAGCTTACTCGAGTAAGCTGCACGTATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032796
VALIDATED
SYAP1 MISSION shRNA Bacterial Glycerol Stock
synapse associated protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-929s1c1
Sequence:CCGGCCTTCGATGCCTGTAACCTAACTCGAGTTAGGTTACAGGCATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-630s1c1
Sequence:CCGGGCTGCTAAGCAAGATGAGATTCTCGAGAATCTCATCTTGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032796.2-1549s1c1
Sequence:CCGGCCTACTTAATGGGTTGATTATCTCGAGATAATCAACCCATTAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-382s1c1
Sequence:CCGGGACAAGACAATTATAGGAGATCTCGAGATCTCCTATAATTGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167475    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032796.2-1232s1c1
Sequence:CCGGGAAGGCATGAAAGAGTATAATCTCGAGATTATACTCTTTCATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032796
VALIDATED
SYAP1 MISSION shRNA shRNA Plasmid DNA
synapse associated protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-929s1c1
Sequence:CCGGCCTTCGATGCCTGTAACCTAACTCGAGTTAGGTTACAGGCATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-630s1c1
Sequence:CCGGGCTGCTAAGCAAGATGAGATTCTCGAGAATCTCATCTTGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032796.2-1549s1c1
Sequence:CCGGCCTACTTAATGGGTTGATTATCTCGAGATAATCAACCCATTAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-382s1c1
Sequence:CCGGGACAAGACAATTATAGGAGATCTCGAGATCTCCTATAATTGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167475    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032796.2-1232s1c1
Sequence:CCGGGAAGGCATGAAAGAGTATAATCTCGAGATTATACTCTTTCATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032796
VALIDATED
SYAP1 MISSION shRNA Lentiviral Transduction Particles
synapse associated protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-929s1c1
Sequence:CCGGCCTTCGATGCCTGTAACCTAACTCGAGTTAGGTTACAGGCATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-630s1c1
Sequence:CCGGGCTGCTAAGCAAGATGAGATTCTCGAGAATCTCATCTTGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032796.2-1549s1c1
Sequence:CCGGCCTACTTAATGGGTTGATTATCTCGAGATAATCAACCCATTAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032796.2-382s1c1
Sequence:CCGGGACAAGACAATTATAGGAGATCTCGAGATCTCCTATAATTGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167475    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032796.2-1232s1c1
Sequence:CCGGGAAGGCATGAAAGAGTATAATCTCGAGATTATACTCTTTCATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks