EMAIL THIS PAGE TO A FRIEND

SYBU

syntabulin (syntaxin-interacting)

Synonyms: GOLSYN OCSYN SNPHL
Gene ID:
Human(55638) Summary: Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]
Mouse(319613) syntabulin (syntaxin-interacting)
Rat(500865) syntabulin (syntaxin-interacting)
Zebrafish(568207) syntabulin (syntaxin-interacting)
Horse(100064295) syntabulin (syntaxin-interacting)
domestic cat(101089329) syntabulin (syntaxin-interacting)
dog(475076) syntabulin (syntaxin-interacting)
chicken(420277) syntabulin (syntaxin-interacting)
naked mole-rat(101725909) syntabulin (syntaxin-interacting)
cow(618577) syntabulin (syntaxin-interacting)
sheep(101122117) syntabulin (syntaxin-interacting)
297 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017786 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087521 MISSION® esiRNA esiRNA targeting mouse 5730410E15Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099743 Rosetta Predictions human pricing
NM_001099744 Rosetta Predictions human pricing
NM_001099745 Rosetta Predictions human pricing
NM_001099746 Rosetta Predictions human pricing
NM_001099747 Rosetta Predictions human pricing
NM_001099748 Rosetta Predictions human pricing
NM_001099749 Rosetta Predictions human pricing
NM_001099750 Rosetta Predictions human pricing
NM_001099751 Rosetta Predictions human pricing
NM_001099752 Rosetta Predictions human pricing
NM_001099753 Rosetta Predictions human pricing
NM_001099754 Rosetta Predictions human pricing
NM_001099755 Rosetta Predictions human pricing
NM_001099756 Rosetta Predictions human pricing
NM_017786 Rosetta Predictions human pricing
XM_001064007 Rosetta Predictions rat pricing
XM_576264 Rosetta Predictions rat pricing
NM_001032727 Rosetta Predictions mouse pricing
NM_176998 Rosetta Predictions mouse pricing
NM_178765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321233 predicted 1139
2 SASI_Hs02_00321234 predicted 1558
3 SASI_Hs02_00321235 predicted 2066
4 SASI_Hs02_00321236 predicted 1252
5 SASI_Hs02_00321237 predicted 2520
6 SASI_Hs02_00321238 predicted 1699
7 SASI_Hs02_00321239 predicted 2121
8 SASI_Hs02_00321240 predicted 1728
9 SASI_Hs02_00321241 predicted 2558
10 SASI_Hs02_00321242 predicted 2225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321243 predicted 1143
2 SASI_Hs02_00321244 predicted 1554
3 SASI_Hs02_00321245 predicted 2070
4 SASI_Hs02_00321246 predicted 1258
5 SASI_Hs02_00321247 predicted 2527
6 SASI_Hs02_00321248 predicted 1700
7 SASI_Hs02_00321249 predicted 2128
8 SASI_Hs02_00321250 predicted 2563
9 SASI_Hs02_00321251 predicted 2230
10 SASI_Hs02_00321252 predicted 2268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321253 predicted 975
2 SASI_Hs02_00321254 predicted 1397
3 SASI_Hs02_00321255 predicted 1907
4 SASI_Hs02_00321256 predicted 1089
5 SASI_Hs02_00321257 predicted 2360
6 SASI_Hs02_00321258 predicted 1542
7 SASI_Hs02_00321259 predicted 1963
8 SASI_Hs02_00321260 predicted 1565
9 SASI_Hs02_00321261 predicted 2400
10 SASI_Hs02_00321262 predicted 2061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321263 predicted 685
2 SASI_Hs02_00321264 predicted 1109
3 SASI_Hs02_00321265 predicted 1618
4 SASI_Hs02_00321266 predicted 803
5 SASI_Hs02_00321267 predicted 2076
6 SASI_Hs02_00321268 predicted 1248
7 SASI_Hs02_00321269 predicted 1678
8 SASI_Hs02_00321270 predicted 2107
9 SASI_Hs02_00321271 predicted 1777
10 SASI_Hs02_00321272 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321273 predicted 893
2 SASI_Hs02_00321274 predicted 1312
3 SASI_Hs02_00321275 predicted 1822
4 SASI_Hs02_00321276 predicted 1016
5 SASI_Hs02_00321277 predicted 2280
6 SASI_Hs02_00321278 predicted 1459
7 SASI_Hs02_00321279 predicted 1876
8 SASI_Hs02_00321280 predicted 1478
9 SASI_Hs02_00321281 predicted 2313
10 SASI_Hs02_00321282 predicted 1982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321283 predicted 894
2 SASI_Hs02_00321284 predicted 1311
3 SASI_Hs02_00321285 predicted 1825
4 SASI_Hs02_00321286 predicted 1018
5 SASI_Hs02_00321287 predicted 2287
6 SASI_Hs02_00321288 predicted 1455
7 SASI_Hs02_00321289 predicted 1880
8 SASI_Hs02_00321290 predicted 1488
9 SASI_Hs02_00321291 predicted 2317
10 SASI_Hs02_00321292 predicted 1988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321293 predicted 611
2 SASI_Hs02_00321294 predicted 1025
3 SASI_Hs02_00321295 predicted 1547
4 SASI_Hs02_00321296 predicted 729
5 SASI_Hs02_00321297 predicted 1995
6 SASI_Hs02_00321298 predicted 1175
7 SASI_Hs02_00321299 predicted 1595
8 SASI_Hs02_00321300 predicted 2027
9 SASI_Hs02_00321301 predicted 1695
10 SASI_Hs02_00321302 predicted 1744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321303 predicted 1016
2 SASI_Hs02_00321304 predicted 1432
3 SASI_Hs02_00321305 predicted 1954
4 SASI_Hs02_00321306 predicted 1137
5 SASI_Hs02_00321307 predicted 2401
6 SASI_Hs02_00321308 predicted 1579
7 SASI_Hs02_00321309 predicted 1999
8 SASI_Hs02_00321310 predicted 2440
9 SASI_Hs02_00321311 predicted 2106
10 SASI_Hs02_00321312 predicted 2151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321313 predicted 986
2 SASI_Hs02_00321314 predicted 1401
3 SASI_Hs02_00321315 predicted 1920
4 SASI_Hs02_00321316 predicted 1102
5 SASI_Hs02_00321317 predicted 2374
6 SASI_Hs02_00321318 predicted 1549
7 SASI_Hs02_00321319 predicted 1972
8 SASI_Hs02_00321320 predicted 2398
9 SASI_Hs02_00321321 predicted 2075
10 SASI_Hs02_00321322 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321323 predicted 989
2 SASI_Hs02_00321324 predicted 1400
3 SASI_Hs02_00321325 predicted 1922
4 SASI_Hs02_00321326 predicted 1106
5 SASI_Hs02_00321327 predicted 2373
6 SASI_Hs02_00321328 predicted 1548
7 SASI_Hs02_00321329 predicted 1967
8 SASI_Hs02_00321330 predicted 1573
9 SASI_Hs02_00321331 predicted 2403
10 SASI_Hs02_00321332 predicted 2072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321333 predicted 786
2 SASI_Hs02_00321334 predicted 1196
3 SASI_Hs02_00321335 predicted 1717
4 SASI_Hs02_00321336 predicted 904
5 SASI_Hs02_00321337 predicted 2169
6 SASI_Hs02_00321338 predicted 1346
7 SASI_Hs02_00321339 predicted 1765
8 SASI_Hs02_00321340 predicted 1374
9 SASI_Hs02_00321341 predicted 2202
10 SASI_Hs02_00321342 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321343 predicted 785
2 SASI_Hs02_00321344 predicted 1205
3 SASI_Hs02_00321345 predicted 1717
4 SASI_Hs02_00321346 predicted 906
5 SASI_Hs02_00321347 predicted 2178
6 SASI_Hs02_00321348 predicted 1354
7 SASI_Hs02_00321349 predicted 1770
8 SASI_Hs02_00321350 predicted 2207
9 SASI_Hs02_00321351 predicted 1874
10 SASI_Hs02_00321352 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321353 predicted 578
2 SASI_Hs02_00321354 predicted 1002
3 SASI_Hs02_00321355 predicted 1517
4 SASI_Hs02_00321356 predicted 695
5 SASI_Hs02_00321357 predicted 1967
6 SASI_Hs02_00321358 predicted 1143
7 SASI_Hs02_00321359 predicted 1568
8 SASI_Hs02_00321360 predicted 1167
9 SASI_Hs02_00321361 predicted 2001
10 SASI_Hs02_00321362 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321363 predicted 862
2 SASI_Hs02_00321364 predicted 1275
3 SASI_Hs02_00321365 predicted 1787
4 SASI_Hs02_00321366 predicted 979
5 SASI_Hs02_00321367 predicted 2244
6 SASI_Hs02_00321368 predicted 1423
7 SASI_Hs02_00321369 predicted 1844
8 SASI_Hs02_00321370 predicted 2275
9 SASI_Hs02_00321371 predicted 1944
10 SASI_Hs02_00321372 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181231 predicted 1013
2 SASI_Hs01_00181234 predicted 1432
3 SASI_Hs02_00350648 predicted 1950
4 SASI_Hs01_00181236 predicted 1137
5 SASI_Hs01_00181238 predicted 2405
6 SASI_Hs02_00350649 predicted 1581
7 SASI_Hs01_00181240 predicted 2003
8 SASI_Hs02_00350650 predicted 1604
9 SASI_Hs02_00350651 predicted 2430
10 SASI_Hs02_00350652 predicted 2103
11 SASI_Hs01_00181232 predicted 1089
12 SASI_Hs01_00181233 predicted 1118
13 SASI_Hs01_00181235 predicted 1113
14 SASI_Hs01_00181237 predicted 2704
15 SASI_Hs01_00181239 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309003 predicted 1153
2 SASI_Rn02_00309004 predicted 2644
3 SASI_Rn02_00309005 predicted 2343
4 SASI_Rn02_00309006 predicted 2752
5 SASI_Rn02_00309007 predicted 2740
6 SASI_Rn02_00309008 predicted 2836
7 SASI_Rn02_00309009 predicted 2331
8 SASI_Rn02_00309010 predicted 2463
9 SASI_Rn02_00309011 predicted 2359
10 SASI_Rn02_00309012 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404973 predicted 899
2 SASI_Rn02_00404974 predicted 2384
3 SASI_Rn02_00404975 predicted 2091
4 SASI_Rn02_00404976 predicted 2508
5 SASI_Rn02_00404977 predicted 2493
6 SASI_Rn02_00404978 predicted 2590
7 SASI_Rn02_00404979 predicted 2081
8 SASI_Rn02_00404980 predicted 2213
9 SASI_Rn02_00404981 predicted 2103
10 SASI_Rn02_00404982 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152365 predicted 1947
2 SASI_Mm01_00152367 predicted 953
3 SASI_Mm01_00152369 predicted 2221
4 SASI_Mm02_00288168 predicted 2103
5 SASI_Mm01_00152370 predicted 1853
6 SASI_Mm01_00152371 predicted 1880
7 SASI_Mm01_00152373 predicted 1210
8 SASI_Mm02_00288169 predicted 1927
9 SASI_Mm02_00288170 predicted 1282
10 SASI_Mm02_00288171 predicted 1339
11 SASI_Mm01_00152364 predicted 2253
12 SASI_Mm01_00152366 predicted 969
13 SASI_Mm01_00152368 predicted 2336
14 SASI_Mm01_00152372 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100659 predicted 2251
2 SASI_Mm01_00100661 predicted 1262
3 SASI_Mm01_00100663 predicted 2527
4 SASI_Mm02_00346930 predicted 2402
5 SASI_Mm01_00100664 predicted 2159
6 SASI_Mm01_00100665 predicted 2186
7 SASI_Mm01_00100667 predicted 1519
8 SASI_Mm02_00346931 predicted 2234
9 SASI_Mm02_00346932 predicted 1596
10 SASI_Mm02_00346933 predicted 1649
11 SASI_Mm01_00100658 predicted 2555
12 SASI_Mm01_00100660 predicted 1276
13 SASI_Mm01_00100662 predicted 2645
14 SASI_Mm01_00100666 predicted 2540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098254 predicted 2152
2 SASI_Mm01_00098256 predicted 1155
3 SASI_Mm01_00098258 predicted 2424
4 SASI_Mm02_00349324 predicted 2301
5 SASI_Mm01_00098259 predicted 2051
6 SASI_Mm01_00098260 predicted 2084
7 SASI_Mm01_00098262 predicted 1408
8 SASI_Mm02_00349325 predicted 2131
9 SASI_Mm02_00349326 predicted 1488
10 SASI_Mm02_00349327 predicted 1544
11 SASI_Mm01_00098253 predicted 2450
12 SASI_Mm01_00098255 predicted 1182
13 SASI_Mm01_00098257 predicted 2542
14 SASI_Mm01_00098261 predicted 2438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178765
SYBU MISSION shRNA Bacterial Glycerol Stock
syntabulin (syntaxin-interacting)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178765.2-1892s1c1
Sequence:CCGGCCTCATGAGAGAGCTAGATTTCTCGAGAAATCTAGCTCTCTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178765.2-1227s1c1
Sequence:CCGGGCTGATAAAGATAAAGGCATTCTCGAGAATGCCTTTATCTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178765.2-2417s1c1
Sequence:CCGGCCCGTTCTTATACTAATGGTTCTCGAGAACCATTAGTATAAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178765.2-2268s1c1
Sequence:CCGGCGCTATTTGATTTGCACTATACTCGAGTATAGTGCAAATCAAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-1233s21c1
Sequence:GTACCGGCCCAAATCCAGAACAGTATTTCTCGAGAAATACTGTTCTGGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-638s21c1
Sequence:GTACCGGGACGCTCAGCAAGGACGATTACTCGAGTAATCGTCCTTGCTGAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-826s21c1
Sequence:GTACCGGATTCAGTCAGCTCGTCATAAACTCGAGTTTATGACGAGCTGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-1674s21c1
Sequence:GTACCGGCAAGTTGCCAGATGGGTTATCCTCGAGGATAACCCATCTGGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178765
SYBU MISSION shRNA shRNA Plasmid DNA
syntabulin (syntaxin-interacting)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178765.2-1892s1c1
Sequence:CCGGCCTCATGAGAGAGCTAGATTTCTCGAGAAATCTAGCTCTCTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178765.2-1227s1c1
Sequence:CCGGGCTGATAAAGATAAAGGCATTCTCGAGAATGCCTTTATCTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178765.2-2417s1c1
Sequence:CCGGCCCGTTCTTATACTAATGGTTCTCGAGAACCATTAGTATAAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178765.2-2268s1c1
Sequence:CCGGCGCTATTTGATTTGCACTATACTCGAGTATAGTGCAAATCAAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-1233s21c1
Sequence:GTACCGGCCCAAATCCAGAACAGTATTTCTCGAGAAATACTGTTCTGGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-638s21c1
Sequence:GTACCGGGACGCTCAGCAAGGACGATTACTCGAGTAATCGTCCTTGCTGAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-826s21c1
Sequence:GTACCGGATTCAGTCAGCTCGTCATAAACTCGAGTTTATGACGAGCTGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-1674s21c1
Sequence:GTACCGGCAAGTTGCCAGATGGGTTATCCTCGAGGATAACCCATCTGGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178765
SYBU MISSION shRNA Lentiviral Transduction Particles
syntabulin (syntaxin-interacting)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178765.2-1892s1c1
Sequence:CCGGCCTCATGAGAGAGCTAGATTTCTCGAGAAATCTAGCTCTCTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178765.2-1227s1c1
Sequence:CCGGGCTGATAAAGATAAAGGCATTCTCGAGAATGCCTTTATCTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178765.2-2417s1c1
Sequence:CCGGCCCGTTCTTATACTAATGGTTCTCGAGAACCATTAGTATAAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178765.2-2268s1c1
Sequence:CCGGCGCTATTTGATTTGCACTATACTCGAGTATAGTGCAAATCAAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-1233s21c1
Sequence:GTACCGGCCCAAATCCAGAACAGTATTTCTCGAGAAATACTGTTCTGGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-638s21c1
Sequence:GTACCGGGACGCTCAGCAAGGACGATTACTCGAGTAATCGTCCTTGCTGAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-826s21c1
Sequence:GTACCGGATTCAGTCAGCTCGTCATAAACTCGAGTTTATGACGAGCTGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178765.3-1674s21c1
Sequence:GTACCGGCAAGTTGCCAGATGGGTTATCCTCGAGGATAACCCATCTGGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017786
SYBU MISSION shRNA Bacterial Glycerol Stock
syntabulin (syntaxin-interacting)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017786.1-362s1c1
Sequence:CCGGGAAGTGATGAAGGCTTCACCACTCGAGTGGTGAAGCCTTCATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-1082s1c1
Sequence:CCGGGCAGCTTGGCTGATAAAGATACTCGAGTATCTTTATCAGCCAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-1359s1c1
Sequence:CCGGCACAGGTTTGTTCGATGAGATCTCGAGATCTCATCGAACAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-931s1c1
Sequence:CCGGGAAAGTGAAATCGTGGAGCTTCTCGAGAAGCTCCACGATTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-840s1c1
Sequence:CCGGGCAGTATTTGACTCCACTGCACTCGAGTGCAGTGGAGTCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017786.1-1261s1c1
Sequence:CCGGCCTCTTGACACAATGGCAGATCTCGAGATCTGCCATTGTGTCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-746s1c1
Sequence:CCGGCCTACAAAGGAAGCGACTGTACTCGAGTACAGTCGCTTCCTTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-862s21c1
Sequence:GTACCGGTTCCGCTCCTGAGGTCCATATCTCGAGATATGGACCTCAGGAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-766s21c1
Sequence:CCGGCATTCAGTCCTCTCGATATAACTCGAGTTATATCGAGAGGACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1186s21c1
Sequence:CCGGGCAGTATTTGACTCCACTGCACTCGAGTGCAGTGGAGTCAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017786.5-2564s21c1
Sequence:CCGGGGAGACCTGGTTCCAGTAAATCTCGAGATTTACTGGAACCAGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1277s21c1
Sequence:CCGGGAAAGTGAAATCGTGGAGCTTCTCGAGAAGCTCCACGATTTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1428s21c1
Sequence:CCGGGCAGCTTGGCTGATAAAGATACTCGAGTATCTTTATCAGCCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017786
SYBU MISSION shRNA shRNA Plasmid DNA
syntabulin (syntaxin-interacting)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017786.1-362s1c1
Sequence:CCGGGAAGTGATGAAGGCTTCACCACTCGAGTGGTGAAGCCTTCATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-1082s1c1
Sequence:CCGGGCAGCTTGGCTGATAAAGATACTCGAGTATCTTTATCAGCCAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-1359s1c1
Sequence:CCGGCACAGGTTTGTTCGATGAGATCTCGAGATCTCATCGAACAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-931s1c1
Sequence:CCGGGAAAGTGAAATCGTGGAGCTTCTCGAGAAGCTCCACGATTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-840s1c1
Sequence:CCGGGCAGTATTTGACTCCACTGCACTCGAGTGCAGTGGAGTCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017786.1-1261s1c1
Sequence:CCGGCCTCTTGACACAATGGCAGATCTCGAGATCTGCCATTGTGTCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-746s1c1
Sequence:CCGGCCTACAAAGGAAGCGACTGTACTCGAGTACAGTCGCTTCCTTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-862s21c1
Sequence:GTACCGGTTCCGCTCCTGAGGTCCATATCTCGAGATATGGACCTCAGGAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-766s21c1
Sequence:CCGGCATTCAGTCCTCTCGATATAACTCGAGTTATATCGAGAGGACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1186s21c1
Sequence:CCGGGCAGTATTTGACTCCACTGCACTCGAGTGCAGTGGAGTCAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017786.5-2564s21c1
Sequence:CCGGGGAGACCTGGTTCCAGTAAATCTCGAGATTTACTGGAACCAGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1277s21c1
Sequence:CCGGGAAAGTGAAATCGTGGAGCTTCTCGAGAAGCTCCACGATTTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1428s21c1
Sequence:CCGGGCAGCTTGGCTGATAAAGATACTCGAGTATCTTTATCAGCCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017786
SYBU MISSION shRNA Lentiviral Transduction Particles
syntabulin (syntaxin-interacting)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017786.1-362s1c1
Sequence:CCGGGAAGTGATGAAGGCTTCACCACTCGAGTGGTGAAGCCTTCATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-1082s1c1
Sequence:CCGGGCAGCTTGGCTGATAAAGATACTCGAGTATCTTTATCAGCCAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-1359s1c1
Sequence:CCGGCACAGGTTTGTTCGATGAGATCTCGAGATCTCATCGAACAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-931s1c1
Sequence:CCGGGAAAGTGAAATCGTGGAGCTTCTCGAGAAGCTCCACGATTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-840s1c1
Sequence:CCGGGCAGTATTTGACTCCACTGCACTCGAGTGCAGTGGAGTCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017786.1-1261s1c1
Sequence:CCGGCCTCTTGACACAATGGCAGATCTCGAGATCTGCCATTGTGTCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017786.1-746s1c1
Sequence:CCGGCCTACAAAGGAAGCGACTGTACTCGAGTACAGTCGCTTCCTTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-862s21c1
Sequence:GTACCGGTTCCGCTCCTGAGGTCCATATCTCGAGATATGGACCTCAGGAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-766s21c1
Sequence:CCGGCATTCAGTCCTCTCGATATAACTCGAGTTATATCGAGAGGACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1186s21c1
Sequence:CCGGGCAGTATTTGACTCCACTGCACTCGAGTGCAGTGGAGTCAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017786.5-2564s21c1
Sequence:CCGGGGAGACCTGGTTCCAGTAAATCTCGAGATTTACTGGAACCAGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1277s21c1
Sequence:CCGGGAAAGTGAAATCGTGGAGCTTCTCGAGAAGCTCCACGATTTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017786.5-1428s21c1
Sequence:CCGGGCAGCTTGGCTGATAAAGATACTCGAGTATCTTTATCAGCCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks