EMAIL THIS PAGE TO A FRIEND

SYCE1

synaptonemal complex central element protein 1

Synonyms: C10orf94 CT76
UniProtKB ID: Q8N0S2, B2RC80, Q9BWU3, Q9BWU4
Gene ID:
Mouse(74075) synaptonemal complex central element protein 1
Rat(502372) synaptonemal complex central element protein 1
cow(782569) synaptonemal complex central element protein 1-like
cow(529478) synaptonemal complex central element protein 1
domestic guinea pig(100720209) synaptonemal complex central element protein 1
domestic cat(101092148) synaptonemal complex central element protein 1
dog(480826) synaptonemal complex central element protein 1
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001143765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001143765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_201564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201564 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130784 Rosetta Predictions human pricing
NM_201564 Rosetta Predictions human pricing
NM_001025058 Rosetta Predictions rat pricing
XM_001472886 Rosetta Predictions mouse pricing
XM_001479666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209216 predicted 551
2 SASI_Hs01_00209217 predicted 487
3 SASI_Hs01_00209218 predicted 480
4 SASI_Hs01_00209220 predicted 435
5 SASI_Hs01_00209221 predicted 448
6 SASI_Hs01_00209222 predicted 486
7 SASI_Hs01_00209223 predicted 561
8 SASI_Hs01_00209219 predicted 428
9 SASI_Hs02_00362817 predicted 690
10 SASI_Hs02_00362818 predicted 691
11 SASI_Hs01_00209224 predicted 516
12 SASI_Hs01_00209225 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197158 predicted 1494
2 SASI_Hs01_00197159 predicted 1420
3 SASI_Hs01_00197160 predicted 1410
4 SASI_Hs01_00197162 predicted 1376
5 SASI_Hs01_00197163 predicted 1378
6 SASI_Hs01_00197164 predicted 1418
7 SASI_Hs01_00197165 predicted 1491
8 SASI_Hs01_00197161 predicted 1366
9 SASI_Hs02_00373056 predicted 1626
10 SASI_Hs02_00373057 predicted 1626
11 SASI_Hs01_00197166 predicted 1450
12 SASI_Hs01_00197167 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074246 predicted 276
2 SASI_Rn01_00074247 predicted 1096
3 SASI_Rn01_00074248 predicted 294
4 SASI_Rn01_00074249 predicted 1087
5 SASI_Rn01_00074250 predicted 394
6 SASI_Rn01_00074251 predicted 1166
7 SASI_Rn01_00074252 predicted 457
8 SASI_Rn01_00074253 predicted 446
9 SASI_Rn01_00074254 predicted 466
10 SASI_Rn01_00074255 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00364456 predicted 612
2 SASI_Mm02_00364457 predicted 719
3 SASI_Mm02_00364458 predicted 1094
4 SASI_Mm02_00364459 predicted 947
5 SASI_Mm02_00364460 predicted 410
6 SASI_Mm02_00364461 predicted 1197
7 SASI_Mm02_00364462 predicted 1250
8 SASI_Mm02_00364463 predicted 394
9 SASI_Mm02_00364464 predicted 310
10 SASI_Mm02_00364465 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00411705 predicted 614
2 SASI_Mm02_00411706 predicted 724
3 SASI_Mm02_00411707 predicted 1092
4 SASI_Mm02_00411708 predicted 947
5 SASI_Mm02_00411709 predicted 409
6 SASI_Mm02_00411710 predicted 1201
7 SASI_Mm02_00411711 predicted 1253
8 SASI_Mm02_00411712 predicted 397
9 SASI_Mm02_00411713 predicted 307
10 SASI_Mm02_00411714 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143765
SYCE1 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex central element protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-362s21c1
Sequence:CCGGGAAGAGACCCTGAGGATTATGCTCGAGCATAATCCTCAGGGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-535s21c1
Sequence:CCGGGACTTTGATGAGTCAACATAACTCGAGTTATGTTGACTCATCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-1012s21c1
Sequence:CCGGCCCATCAAGCAGGACCTAATACTCGAGTATTAGGTCCTGCTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143765.1-1208s21c1
Sequence:CCGGACACTGCAGACCCTTAGTAAACTCGAGTTTACTAAGGGTCTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-208s21c1
Sequence:CCGGGGTCCTGATTAACCGTATTAACTCGAGTTAATACGGTTAATCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143765
SYCE1 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex central element protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-362s21c1
Sequence:CCGGGAAGAGACCCTGAGGATTATGCTCGAGCATAATCCTCAGGGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-535s21c1
Sequence:CCGGGACTTTGATGAGTCAACATAACTCGAGTTATGTTGACTCATCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-1012s21c1
Sequence:CCGGCCCATCAAGCAGGACCTAATACTCGAGTATTAGGTCCTGCTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143765.1-1208s21c1
Sequence:CCGGACACTGCAGACCCTTAGTAAACTCGAGTTTACTAAGGGTCTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-208s21c1
Sequence:CCGGGGTCCTGATTAACCGTATTAACTCGAGTTAATACGGTTAATCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143765
SYCE1 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex central element protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-362s21c1
Sequence:CCGGGAAGAGACCCTGAGGATTATGCTCGAGCATAATCCTCAGGGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-535s21c1
Sequence:CCGGGACTTTGATGAGTCAACATAACTCGAGTTATGTTGACTCATCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-1012s21c1
Sequence:CCGGCCCATCAAGCAGGACCTAATACTCGAGTATTAGGTCCTGCTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143765.1-1208s21c1
Sequence:CCGGACACTGCAGACCCTTAGTAAACTCGAGTTTACTAAGGGTCTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143765.1-208s21c1
Sequence:CCGGGGTCCTGATTAACCGTATTAACTCGAGTTAATACGGTTAATCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201564
SYCE1 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex central element protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201564.1-2158s1c1
Sequence:CCGGGCCCACAATTAGAAGGAACTTCTCGAGAAGTTCCTTCTAATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1393s1c1
Sequence:CCGGGATTGAAGAAGAGAAGAACAACTCGAGTTGTTCTTCTCTTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1390s1c1
Sequence:CCGGGCAGATTGAAGAAGAGAAGAACTCGAGTTCTTCTCTTCTTCAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201564.1-2008s1c1
Sequence:CCGGCGAGTTCTCTAAGATGCAGTTCTCGAGAACTGCATCTTAGAGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1411s1c1
Sequence:CCGGCAAACAGAGACAGCTGAGGTTCTCGAGAACCTCAGCTGTCTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1379s1c1
Sequence:CCGGGCCCTGAACTTGCAGATTGAACTCGAGTTCAATCTGCAAGTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201564
SYCE1 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex central element protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201564.1-2158s1c1
Sequence:CCGGGCCCACAATTAGAAGGAACTTCTCGAGAAGTTCCTTCTAATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1393s1c1
Sequence:CCGGGATTGAAGAAGAGAAGAACAACTCGAGTTGTTCTTCTCTTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1390s1c1
Sequence:CCGGGCAGATTGAAGAAGAGAAGAACTCGAGTTCTTCTCTTCTTCAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201564.1-2008s1c1
Sequence:CCGGCGAGTTCTCTAAGATGCAGTTCTCGAGAACTGCATCTTAGAGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1411s1c1
Sequence:CCGGCAAACAGAGACAGCTGAGGTTCTCGAGAACCTCAGCTGTCTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1379s1c1
Sequence:CCGGGCCCTGAACTTGCAGATTGAACTCGAGTTCAATCTGCAAGTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201564
SYCE1 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex central element protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201564.1-2158s1c1
Sequence:CCGGGCCCACAATTAGAAGGAACTTCTCGAGAAGTTCCTTCTAATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1393s1c1
Sequence:CCGGGATTGAAGAAGAGAAGAACAACTCGAGTTGTTCTTCTCTTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1390s1c1
Sequence:CCGGGCAGATTGAAGAAGAGAAGAACTCGAGTTCTTCTCTTCTTCAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201564.1-2008s1c1
Sequence:CCGGCGAGTTCTCTAAGATGCAGTTCTCGAGAACTGCATCTTAGAGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1411s1c1
Sequence:CCGGCAAACAGAGACAGCTGAGGTTCTCGAGAACCTCAGCTGTCTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201564.1-1379s1c1
Sequence:CCGGGCCCTGAACTTGCAGATTGAACTCGAGTTCAATCTGCAAGTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks