EMAIL THIS PAGE TO A FRIEND

SYCE1L

synaptonemal complex central element protein 1-like

Synonyms: MRP2
UniProtKB ID: A8MT33, A6NF23
Gene ID:
Mouse(668110) synaptonemal complex central element protein 1 like
Rat(100361431) synaptonemal complex central element protein 1-like
domestic cat(101098350) synaptonemal complex central element protein 1-like
domestic guinea pig(101788089) synaptonemal complex central element protein 1-like
cow(100847635) synaptonemal complex central element protein 1-like
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129979 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001048145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001048145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001048145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717986 Rosetta Predictions human pricing
XM_001718777 Rosetta Predictions human pricing
XM_001719609 Rosetta Predictions human pricing
NM_001048145 Rosetta Predictions mouse pricing
NM_029139 Rosetta Predictions mouse pricing
XM_001004668 Rosetta Predictions mouse pricing
XM_001004671 Rosetta Predictions mouse pricing
XM_001004675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00420931 predicted 342
2 SASI_Hs02_00420932 predicted 350
3 SASI_Hs02_00420933 predicted 242
4 SASI_Hs02_00420934 predicted 346
5 SASI_Hs02_00420935 predicted 321
6 SASI_Hs02_00420936 predicted 248
7 SASI_Hs02_00420937 predicted 215
8 SASI_Hs02_00420938 predicted 272
9 SASI_Hs02_00420939 predicted 443
10 SASI_Hs02_00420940 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426251 predicted 344
2 SASI_Hs02_00426252 predicted 350
3 SASI_Hs02_00426253 predicted 237
4 SASI_Hs02_00426254 predicted 352
5 SASI_Hs02_00426255 predicted 318
6 SASI_Hs02_00426256 predicted 253
7 SASI_Hs02_00426257 predicted 217
8 SASI_Hs02_00426258 predicted 267
9 SASI_Hs02_00426259 predicted 440
10 SASI_Hs02_00426260 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00431483 predicted 346
2 SASI_Hs02_00431484 predicted 353
3 SASI_Hs02_00431485 predicted 235
4 SASI_Hs02_00431486 predicted 351
5 SASI_Hs02_00431487 predicted 318
6 SASI_Hs02_00431488 predicted 248
7 SASI_Hs02_00431489 predicted 209
8 SASI_Hs02_00431490 predicted 268
9 SASI_Hs02_00431491 predicted 441
10 SASI_Hs02_00431492 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292051 predicted 276
2 SASI_Mm02_00292052 predicted 379
3 SASI_Mm02_00292053 predicted 267
4 SASI_Mm02_00292054 predicted 270
5 SASI_Mm02_00292055 predicted 370
6 SASI_Mm02_00292056 predicted 378
7 SASI_Mm02_00292057 predicted 500
8 SASI_Mm02_00292058 predicted 330
9 SASI_Mm02_00292059 predicted 280
10 SASI_Mm02_00292060 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334918 predicted 276
2 SASI_Mm02_00334919 predicted 378
3 SASI_Mm02_00334920 predicted 378
4 SASI_Mm02_00334921 predicted 263
5 SASI_Mm02_00334922 predicted 405
6 SASI_Mm02_00334923 predicted 387
7 SASI_Mm02_00334924 predicted 562
8 SASI_Mm02_00334925 predicted 329
9 SASI_Mm02_00334926 predicted 408
10 SASI_Mm02_00334927 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219904 predicted 1461
2 SASI_Mm01_00219905 predicted 1249
3 SASI_Mm01_00219906 predicted 1243
4 SASI_Mm01_00219907 predicted 1245
5 SASI_Mm01_00219908 predicted 1342
6 SASI_Mm01_00219909 predicted 1145
7 SASI_Mm01_00219910 predicted 1353
8 SASI_Mm01_00219911 predicted 1306
9 SASI_Mm01_00219912 predicted 1664
10 SASI_Mm01_00219913 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284496 predicted 1526
2 SASI_Mm01_00284497 predicted 1524
3 SASI_Mm01_00284498 predicted 1255
4 SASI_Mm01_00284499 predicted 1644
5 SASI_Mm01_00284500 predicted 1342
6 SASI_Mm01_00284501 predicted 1315
7 SASI_Mm01_00284502 predicted 1756
8 SASI_Mm01_00284503 predicted 1685
9 SASI_Mm01_00284504 predicted 1748
10 SASI_Mm01_00284505 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257827 predicted 1295
2 SASI_Mm01_00257828 predicted 1281
3 SASI_Mm01_00257829 predicted 1281
4 SASI_Mm01_00257830 predicted 1192
5 SASI_Mm01_00257831 predicted 1576
6 SASI_Mm01_00257832 predicted 1254
7 SASI_Mm01_00257833 predicted 1695
8 SASI_Mm01_00257834 predicted 1625
9 SASI_Mm01_00257835 predicted 1688
10 SASI_Mm01_00257836 predicted 1702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129979
SYCE1L MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex central element protein 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-321s21c1
Sequence:CCGGCCAGATGCACTGCCAAGAGAACTCGAGTTCTCTTGGCAGTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-58s21c1
Sequence:CCGGGAAGGGCAAGCCAAGTCTTTGCTCGAGCAAAGACTTGGCTTGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-137s21c1
Sequence:CCGGCACAGATAGAGGACCTGATTACTCGAGTAATCAGGTCCTCTATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-585s21c1
Sequence:CCGGGAAGGCGGAGCTGGAGATATTCTCGAGAATATCTCCAGCTCCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-230s21c1
Sequence:CCGGAGGCCCTGCATAGGGAATTAGCTCGAGCTAATTCCCTATGCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129979
SYCE1L MISSION shRNA shRNA Plasmid DNA
synaptonemal complex central element protein 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-321s21c1
Sequence:CCGGCCAGATGCACTGCCAAGAGAACTCGAGTTCTCTTGGCAGTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-58s21c1
Sequence:CCGGGAAGGGCAAGCCAAGTCTTTGCTCGAGCAAAGACTTGGCTTGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-137s21c1
Sequence:CCGGCACAGATAGAGGACCTGATTACTCGAGTAATCAGGTCCTCTATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-585s21c1
Sequence:CCGGGAAGGCGGAGCTGGAGATATTCTCGAGAATATCTCCAGCTCCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-230s21c1
Sequence:CCGGAGGCCCTGCATAGGGAATTAGCTCGAGCTAATTCCCTATGCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129979
SYCE1L MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex central element protein 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-321s21c1
Sequence:CCGGCCAGATGCACTGCCAAGAGAACTCGAGTTCTCTTGGCAGTGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-58s21c1
Sequence:CCGGGAAGGGCAAGCCAAGTCTTTGCTCGAGCAAAGACTTGGCTTGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-137s21c1
Sequence:CCGGCACAGATAGAGGACCTGATTACTCGAGTAATCAGGTCCTCTATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-585s21c1
Sequence:CCGGGAAGGCGGAGCTGGAGATATTCTCGAGAATATCTCCAGCTCCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129979.1-230s21c1
Sequence:CCGGAGGCCCTGCATAGGGAATTAGCTCGAGCTAATTCCCTATGCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048145
SYCE1L MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex central element protein 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-280s21c1
Sequence:CCGGAGGGAACTAGACTCCTTAAATCTCGAGATTTAAGGAGTCTAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-101s21c1
Sequence:CCGGCATCTCTGAATACGATGGAAGCTCGAGCTTCCATCGTATTCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-181s21c1
Sequence:CCGGGACCTGATCCACCGCATTAATCTCGAGATTAATGCGGTGGATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-338s21c1
Sequence:CCGGAGCAAGAGGCTGTGTCAATTCCTCGAGGAATTGACACAGCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-395s21c1
Sequence:CCGGCACACTTGGATGCTCAACAACCTCGAGGTTGTTGAGCATCCAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048145
SYCE1L MISSION shRNA shRNA Plasmid DNA
synaptonemal complex central element protein 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-280s21c1
Sequence:CCGGAGGGAACTAGACTCCTTAAATCTCGAGATTTAAGGAGTCTAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-101s21c1
Sequence:CCGGCATCTCTGAATACGATGGAAGCTCGAGCTTCCATCGTATTCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-181s21c1
Sequence:CCGGGACCTGATCCACCGCATTAATCTCGAGATTAATGCGGTGGATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-338s21c1
Sequence:CCGGAGCAAGAGGCTGTGTCAATTCCTCGAGGAATTGACACAGCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-395s21c1
Sequence:CCGGCACACTTGGATGCTCAACAACCTCGAGGTTGTTGAGCATCCAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048145
SYCE1L MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex central element protein 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-280s21c1
Sequence:CCGGAGGGAACTAGACTCCTTAAATCTCGAGATTTAAGGAGTCTAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-101s21c1
Sequence:CCGGCATCTCTGAATACGATGGAAGCTCGAGCTTCCATCGTATTCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-181s21c1
Sequence:CCGGGACCTGATCCACCGCATTAATCTCGAGATTAATGCGGTGGATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-338s21c1
Sequence:CCGGAGCAAGAGGCTGTGTCAATTCCTCGAGGAATTGACACAGCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048145.1-395s21c1
Sequence:CCGGCACACTTGGATGCTCAACAACCTCGAGGTTGTTGAGCATCCAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks