EMAIL THIS PAGE TO A FRIEND

SYCE2

synaptonemal complex central element protein 2

Synonyms: CESC1
UniProtKB ID: Q6PIF2, B4DYD3
Gene ID:
Human(256126) Summary: The protein encoded by this gene is part of the synaptonemal complex formed between homologous chromosomes during meiotic prophase. The encoded protein associates with SYCP1 and SYCE1 and is found only where chromosome cores are synapsed. [provided by RefSeq, Dec 2012]
Mouse(71846) synaptonemal complex central element protein 2
Rat(364976) synaptonemal complex central element protein 2
cow(100141142) synaptonemal complex central element protein 2
domestic guinea pig(100728418) synaptonemal complex central element protein 2
naked mole-rat(101717770) synaptonemal complex central element protein 2
Zebrafish(553132) synaptonemal complex central element protein 2
dog(484923) synaptonemal complex central element protein 2
chicken(100859541) synaptonemal complex central element protein 2
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001105578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105578 Rosetta Predictions human pricing
XM_001071232 Rosetta Predictions rat pricing
XM_344745 Rosetta Predictions rat pricing
NM_027954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324581 predicted 348
2 SASI_Hs02_00324582 predicted 296
3 SASI_Hs02_00324583 predicted 277
4 SASI_Hs02_00324584 predicted 320
5 SASI_Hs02_00324585 predicted 496
6 SASI_Hs02_00324586 predicted 332
7 SASI_Hs02_00324587 predicted 204
8 SASI_Hs02_00324588 predicted 347
9 SASI_Hs02_00324589 predicted 274
10 SASI_Hs02_00324590 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334267 predicted 259
2 SASI_Rn02_00334268 predicted 329
3 SASI_Rn02_00334269 predicted 246
4 SASI_Rn02_00334270 predicted 464
5 SASI_Rn02_00334271 predicted 446
6 SASI_Rn02_00334272 predicted 447
7 SASI_Rn02_00334273 predicted 246
8 SASI_Rn02_00334274 predicted 583
9 SASI_Rn02_00334275 predicted 373
10 SASI_Rn02_00334276 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397500 predicted 266
2 SASI_Rn02_00397501 predicted 330
3 SASI_Rn02_00397502 predicted 246
4 SASI_Rn02_00397503 predicted 473
5 SASI_Rn02_00397504 predicted 441
6 SASI_Rn02_00397505 predicted 452
7 SASI_Rn02_00397506 predicted 249
8 SASI_Rn02_00397507 predicted 581
9 SASI_Rn02_00397508 predicted 370
10 SASI_Rn02_00397509 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167176 predicted 531
2 SASI_Mm01_00167177 predicted 371
3 SASI_Mm01_00167178 predicted 554
4 SASI_Mm01_00167179 predicted 599
5 SASI_Mm01_00167180 predicted 431
6 SASI_Mm01_00167181 predicted 522
7 SASI_Mm01_00167182 predicted 547
8 SASI_Mm01_00167183 predicted 281
9 SASI_Mm01_00167184 predicted 520
10 SASI_Mm01_00167185 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105578
SYCE2 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex central element protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-470s21c1
Sequence:CCGGGCGTGGAGACTGTGTACAAAGCTCGAGCTTTGTACACAGTCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-437s21c1
Sequence:CCGGATTTGGAGACAGAGCTCAAACCTCGAGGTTTGAGCTCTGTCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105578.1-762s21c1
Sequence:CCGGTGGTTCTATAATGCATCTTGGCTCGAGCCAAGATGCATTATAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-351s21c1
Sequence:CCGGGAGGATCTATCAGATTTATAACTCGAGTTATAAATCTGATAGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-281s21c1
Sequence:CCGGATGCACTCATGACCAACTTCACTCGAGTGAAGTTGGTCATGAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105578
SYCE2 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex central element protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-470s21c1
Sequence:CCGGGCGTGGAGACTGTGTACAAAGCTCGAGCTTTGTACACAGTCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-437s21c1
Sequence:CCGGATTTGGAGACAGAGCTCAAACCTCGAGGTTTGAGCTCTGTCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105578.1-762s21c1
Sequence:CCGGTGGTTCTATAATGCATCTTGGCTCGAGCCAAGATGCATTATAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-351s21c1
Sequence:CCGGGAGGATCTATCAGATTTATAACTCGAGTTATAAATCTGATAGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-281s21c1
Sequence:CCGGATGCACTCATGACCAACTTCACTCGAGTGAAGTTGGTCATGAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105578
SYCE2 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex central element protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-470s21c1
Sequence:CCGGGCGTGGAGACTGTGTACAAAGCTCGAGCTTTGTACACAGTCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-437s21c1
Sequence:CCGGATTTGGAGACAGAGCTCAAACCTCGAGGTTTGAGCTCTGTCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105578.1-762s21c1
Sequence:CCGGTGGTTCTATAATGCATCTTGGCTCGAGCCAAGATGCATTATAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-351s21c1
Sequence:CCGGGAGGATCTATCAGATTTATAACTCGAGTTATAAATCTGATAGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105578.1-281s21c1
Sequence:CCGGATGCACTCATGACCAACTTCACTCGAGTGAAGTTGGTCATGAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027954
SYCE2 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex central element protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-514s1c1
Sequence:CCGGGCAAAGATCAACCATCTGGAACTCGAGTTCCAGATGGTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-369s1c1
Sequence:CCGGCCATGCACTTATGACCAACTTCTCGAGAAGTTGGTCATAAGTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-297s1c1
Sequence:CCGGCTCTAGCATTGAAACCCTGAACTCGAGTTCAGGGTTTCAATGCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027954.1-659s1c1
Sequence:CCGGGCTTCCATCTCAATGTGAGAACTCGAGTTCTCACATTGAGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-481s1c1
Sequence:CCGGCAGGAAAGACTACAAGAATTTCTCGAGAAATTCTTGTAGTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027954
SYCE2 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex central element protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-514s1c1
Sequence:CCGGGCAAAGATCAACCATCTGGAACTCGAGTTCCAGATGGTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-369s1c1
Sequence:CCGGCCATGCACTTATGACCAACTTCTCGAGAAGTTGGTCATAAGTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-297s1c1
Sequence:CCGGCTCTAGCATTGAAACCCTGAACTCGAGTTCAGGGTTTCAATGCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027954.1-659s1c1
Sequence:CCGGGCTTCCATCTCAATGTGAGAACTCGAGTTCTCACATTGAGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-481s1c1
Sequence:CCGGCAGGAAAGACTACAAGAATTTCTCGAGAAATTCTTGTAGTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027954
SYCE2 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex central element protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-514s1c1
Sequence:CCGGGCAAAGATCAACCATCTGGAACTCGAGTTCCAGATGGTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-369s1c1
Sequence:CCGGCCATGCACTTATGACCAACTTCTCGAGAAGTTGGTCATAAGTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-297s1c1
Sequence:CCGGCTCTAGCATTGAAACCCTGAACTCGAGTTCAGGGTTTCAATGCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027954.1-659s1c1
Sequence:CCGGGCTTCCATCTCAATGTGAGAACTCGAGTTCTCACATTGAGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027954.1-481s1c1
Sequence:CCGGCAGGAAAGACTACAAGAATTTCTCGAGAAATTCTTGTAGTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks