EMAIL THIS PAGE TO A FRIEND

SYCE3

synaptonemal complex central element protein 3

Synonyms: C22orf41 THEG2
UniProtKB ID: A1L190
Gene ID:
Mouse(75459) synaptonemal complex central element protein 3
Rat(689933) synaptonemal complex central element protein 3
chicken(769096) synaptonemal complex central element protein 3
dog(100685583) synaptonemal complex central element protein 3
domestic cat(101082927) synaptonemal complex central element protein 3
naked mole-rat(101725380) synaptonemal complex central element protein 3
domestic guinea pig(100718256) synaptonemal complex central element protein 3
cow(790482) synaptonemal complex central element protein 3
sheep(101122015) synaptonemal complex central element protein 3
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123225 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123225 Rosetta Predictions human pricing
XM_001720205 Rosetta Predictions human pricing
XM_927380 Rosetta Predictions human pricing
XM_938334 Rosetta Predictions human pricing
XM_001072583 Rosetta Predictions rat pricing
XM_619346 Rosetta Predictions mouse pricing
XM_908448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327735 predicted 199
2 SASI_Hs02_00327736 predicted 205
3 SASI_Hs02_00327737 predicted 87
4 SASI_Hs02_00327738 predicted 324
5 SASI_Hs02_00327739 predicted 281
6 SASI_Hs02_00327740 predicted 378
7 SASI_Hs02_00327741 predicted 268
8 SASI_Hs02_00327742 predicted 155
9 SASI_Hs02_00327743 predicted 392
10 SASI_Hs02_00327744 predicted 164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00435253 predicted 199
2 SASI_Hs02_00435254 predicted 206
3 SASI_Hs02_00435255 predicted 92
4 SASI_Hs02_00435256 predicted 331
5 SASI_Hs02_00435257 predicted 274
6 SASI_Hs02_00435258 predicted 377
7 SASI_Hs02_00435259 predicted 263
8 SASI_Hs02_00435260 predicted 160
9 SASI_Hs02_00435261 predicted 394
10 SASI_Hs02_00435262 predicted 166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263659 predicted 200
2 SASI_Hs01_00263660 predicted 204
3 SASI_Hs01_00263661 predicted 59
4 SASI_Hs01_00263662 predicted 99
5 SASI_Hs01_00263663 predicted 339
6 SASI_Hs01_00263664 predicted 278
7 SASI_Hs01_00263665 predicted 380
8 SASI_Hs01_00263666 predicted 269
9 SASI_Hs01_00263667 predicted 396
10 SASI_Hs01_00263668 predicted 165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483054 predicted 195
2 SASI_Hs02_00483055 predicted 203
3 SASI_Hs02_00483056 predicted 88
4 SASI_Hs02_00483057 predicted 328
5 SASI_Hs02_00483058 predicted 282
6 SASI_Hs02_00483059 predicted 375
7 SASI_Hs02_00483060 predicted 271
8 SASI_Hs02_00483061 predicted 152
9 SASI_Hs02_00483062 predicted 387
10 SASI_Hs02_00483063 predicted 161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339759 predicted 399
2 SASI_Rn02_00339760 predicted 529
3 SASI_Rn02_00339761 predicted 466
4 SASI_Rn02_00339762 predicted 287
5 SASI_Rn02_00339763 predicted 396
6 SASI_Rn02_00339764 predicted 537
7 SASI_Rn02_00339765 predicted 393
8 SASI_Rn02_00339766 predicted 469
9 SASI_Rn02_00339767 predicted 287
10 SASI_Rn02_00339768 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427374 predicted 405
2 SASI_Mm01_00247611 predicted 393
3 SASI_Mm01_00247612 predicted 174
4 SASI_Mm01_00247613 predicted 397
5 SASI_Mm02_00427375 predicted 244
6 SASI_Mm01_00247615 predicted 317
7 SASI_Mm01_00247616 predicted 193
8 SASI_Mm02_00427376 predicted 184
9 SASI_Mm01_00247617 predicted 301
10 SASI_Mm01_00247619 predicted 114
11 SASI_Mm01_00247610 predicted 151
12 SASI_Mm01_00247614 predicted 182
13 SASI_Mm01_00247618 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434112 predicted 402
2 SASI_Mm02_00434113 predicted 398
3 SASI_Mm02_00434114 predicted 179
4 SASI_Mm02_00434115 predicted 400
5 SASI_Mm02_00434116 predicted 244
6 SASI_Mm02_00434117 predicted 319
7 SASI_Mm02_00434118 predicted 185
8 SASI_Mm02_00434119 predicted 181
9 SASI_Mm02_00434120 predicted 305
10 SASI_Mm02_00434121 predicted 115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123225
SYCE3 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex central element protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-230s21c1
Sequence:CCGGAGGATGCCTTCGTCAACTGCACTCGAGTGCAGTTGACGAAGGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-123s21c1
Sequence:CCGGGCTATTAGAAGAGATGGAGAACTCGAGTTCTCCATCTCTTCTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-168s21c1
Sequence:CCGGGGCCTATGACATGGTGGTGATCTCGAGATCACCACCATGTCATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-98s21c1
Sequence:CCGGCAGATCTGAATAAGGACTTGGCTCGAGCCAAGTCCTTATTCAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-259s21c1
Sequence:CCGGATGGAGAAGAACTGGCAAGAGCTCGAGCTCTTGCCAGTTCTTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123225
SYCE3 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex central element protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-230s21c1
Sequence:CCGGAGGATGCCTTCGTCAACTGCACTCGAGTGCAGTTGACGAAGGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-123s21c1
Sequence:CCGGGCTATTAGAAGAGATGGAGAACTCGAGTTCTCCATCTCTTCTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-168s21c1
Sequence:CCGGGGCCTATGACATGGTGGTGATCTCGAGATCACCACCATGTCATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-98s21c1
Sequence:CCGGCAGATCTGAATAAGGACTTGGCTCGAGCCAAGTCCTTATTCAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-259s21c1
Sequence:CCGGATGGAGAAGAACTGGCAAGAGCTCGAGCTCTTGCCAGTTCTTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123225
SYCE3 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex central element protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-230s21c1
Sequence:CCGGAGGATGCCTTCGTCAACTGCACTCGAGTGCAGTTGACGAAGGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-123s21c1
Sequence:CCGGGCTATTAGAAGAGATGGAGAACTCGAGTTCTCCATCTCTTCTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-168s21c1
Sequence:CCGGGGCCTATGACATGGTGGTGATCTCGAGATCACCACCATGTCATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-98s21c1
Sequence:CCGGCAGATCTGAATAAGGACTTGGCTCGAGCCAAGTCCTTATTCAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123225.1-259s21c1
Sequence:CCGGATGGAGAAGAACTGGCAAGAGCTCGAGCTCTTGCCAGTTCTTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks