EMAIL THIS PAGE TO A FRIEND

SYCN

syncollin

Synonyms: INSSA1 SYL
UniProtKB ID: Q0VAF6
Gene ID:
Mouse(68416) syncollin
Rat(245917) syncollin
cow(100139567) syncollin
sheep(101115647) syncollin
chicken(100858140) syncollin
dog(612545) syncollin
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0282 AQUA Peptide FSTGSYP[R] human, mouse, rat pricing
AQ0283 AQUA Peptide GIFGTWA[K] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080468 Rosetta Predictions human pricing
XM_371167 Rosetta Predictions human pricing
XM_929456 Rosetta Predictions human pricing
NM_139086 Rosetta Predictions rat pricing
NM_026716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315126 predicted 203
2 SASI_Hs02_00315127 predicted 255
3 SASI_Hs02_00315128 predicted 225
4 SASI_Hs02_00315129 predicted 226
5 SASI_Hs02_00315130 predicted 216
6 SASI_Hs02_00315131 predicted 239
7 SASI_Hs02_00315132 predicted 210
8 SASI_Hs02_00315133 predicted 122
9 SASI_Hs02_00315134 predicted 110
10 SASI_Hs02_00315135 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284090 predicted 303
2 SASI_Hs01_00284091 predicted 305
3 SASI_Hs01_00284092 predicted 310
4 SASI_Hs01_00284093 predicted 341
5 SASI_Hs01_00284094 predicted 266
6 SASI_Hs01_00284095 predicted 236
7 SASI_Hs01_00284096 predicted 220
8 SASI_Hs01_00284097 predicted 321
9 SASI_Hs01_00284098 predicted 241
10 SASI_Hs01_00284099 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291158 predicted 623
2 SASI_Hs01_00291159 predicted 798
3 SASI_Hs01_00291160 predicted 797
4 SASI_Hs01_00291161 predicted 799
5 SASI_Hs01_00291162 predicted 539
6 SASI_Hs01_00291163 predicted 621
7 SASI_Hs01_00291164 predicted 755
8 SASI_Hs01_00291165 predicted 606
9 SASI_Hs01_00291166 predicted 604
10 SASI_Hs01_00291167 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033831 predicted 303
2 SASI_Rn02_00268448 predicted 397
3 SASI_Rn01_00033832 predicted 324
4 SASI_Rn01_00033833 predicted 375
5 SASI_Rn01_00033834 predicted 197
6 SASI_Rn02_00268449 predicted 397
7 SASI_Rn01_00033836 predicted 297
8 SASI_Rn01_00033837 predicted 372
9 SASI_Rn01_00033838 predicted 195
10 SASI_Rn01_00033840 predicted 94
11 SASI_Rn01_00033835 predicted 157
12 SASI_Rn01_00033839 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027057 predicted 245
2 SASI_Mm01_00027058 predicted 229
3 SASI_Mm02_00330751 predicted 202
4 SASI_Mm01_00027060 predicted 324
5 SASI_Mm01_00027061 predicted 322
6 SASI_Mm01_00027063 predicted 228
7 SASI_Mm01_00027064 predicted 242
8 SASI_Mm01_00027065 predicted 226
9 SASI_Mm02_00330752 predicted 209
10 SASI_Mm02_00330753 predicted 223
11 SASI_Mm01_00027059 predicted 269
12 SASI_Mm01_00027062 predicted 329
13 SASI_Mm01_00027066 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080468
SYCN MISSION shRNA Bacterial Glycerol Stock
syncollin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-304s21c1
Sequence:CCGGGGCAAGACGCACAAGTTCTCTCTCGAGAGAGAACTTGTGCGTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-234s21c1
Sequence:CCGGCAACACCGCCTCCTCACTTGTCTCGAGACAAGTGAGGAGGCGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-151s21c1
Sequence:CCGGCCCTACTATGAGAACTGCTGCCTCGAGGCAGCAGTTCTCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-104s21c1
Sequence:CCGGACTCGGACGGGACGCGCACTTCTCGAGAAGTGCGCGTCCCGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-125s21c1
Sequence:CCGGGCGCCAAGCTCTATGACAAGACTCGAGTCTTGTCATAGAGCTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080468
SYCN MISSION shRNA shRNA Plasmid DNA
syncollin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-304s21c1
Sequence:CCGGGGCAAGACGCACAAGTTCTCTCTCGAGAGAGAACTTGTGCGTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-234s21c1
Sequence:CCGGCAACACCGCCTCCTCACTTGTCTCGAGACAAGTGAGGAGGCGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-151s21c1
Sequence:CCGGCCCTACTATGAGAACTGCTGCCTCGAGGCAGCAGTTCTCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-104s21c1
Sequence:CCGGACTCGGACGGGACGCGCACTTCTCGAGAAGTGCGCGTCCCGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-125s21c1
Sequence:CCGGGCGCCAAGCTCTATGACAAGACTCGAGTCTTGTCATAGAGCTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080468
SYCN MISSION shRNA Lentiviral Transduction Particles
syncollin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-304s21c1
Sequence:CCGGGGCAAGACGCACAAGTTCTCTCTCGAGAGAGAACTTGTGCGTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-234s21c1
Sequence:CCGGCAACACCGCCTCCTCACTTGTCTCGAGACAAGTGAGGAGGCGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-151s21c1
Sequence:CCGGCCCTACTATGAGAACTGCTGCCTCGAGGCAGCAGTTCTCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-104s21c1
Sequence:CCGGACTCGGACGGGACGCGCACTTCTCGAGAAGTGCGCGTCCCGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080468.2-125s21c1
Sequence:CCGGGCGCCAAGCTCTATGACAAGACTCGAGTCTTGTCATAGAGCTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026716
SYCN MISSION shRNA Bacterial Glycerol Stock
syncollin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-104s1c1
Sequence:CCGGGCAGACCTGAAGAAGTCAGATCTCGAGATCTGACTTCTTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-152s1c1
Sequence:CCGGGAGAAGAGTGATCCATACTATCTCGAGATAGTATGGATCACTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-237s1c1
Sequence:CCGGCGGGCTGGTCTAACACTGCATCTCGAGATGCAGTGTTAGACCAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-209s1c1
Sequence:CCGGCCAGGTACTGACCTGCCCTATCTCGAGATAGGGCAGGTCAGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-353s1c1
Sequence:CCGGCGCCTGGAAGAGTACCGCAAACTCGAGTTTGCGGTACTCTTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026716
SYCN MISSION shRNA shRNA Plasmid DNA
syncollin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-104s1c1
Sequence:CCGGGCAGACCTGAAGAAGTCAGATCTCGAGATCTGACTTCTTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-152s1c1
Sequence:CCGGGAGAAGAGTGATCCATACTATCTCGAGATAGTATGGATCACTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-237s1c1
Sequence:CCGGCGGGCTGGTCTAACACTGCATCTCGAGATGCAGTGTTAGACCAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-209s1c1
Sequence:CCGGCCAGGTACTGACCTGCCCTATCTCGAGATAGGGCAGGTCAGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-353s1c1
Sequence:CCGGCGCCTGGAAGAGTACCGCAAACTCGAGTTTGCGGTACTCTTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026716
SYCN MISSION shRNA Lentiviral Transduction Particles
syncollin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-104s1c1
Sequence:CCGGGCAGACCTGAAGAAGTCAGATCTCGAGATCTGACTTCTTCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-152s1c1
Sequence:CCGGGAGAAGAGTGATCCATACTATCTCGAGATAGTATGGATCACTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-237s1c1
Sequence:CCGGCGGGCTGGTCTAACACTGCATCTCGAGATGCAGTGTTAGACCAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-209s1c1
Sequence:CCGGCCAGGTACTGACCTGCCCTATCTCGAGATAGGGCAGGTCAGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026716.2-353s1c1
Sequence:CCGGCGCCTGGAAGAGTACCGCAAACTCGAGTTTGCGGTACTCTTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks