EMAIL THIS PAGE TO A FRIEND

SYCP1

synaptonemal complex protein 1

Synonyms: CT8 HOM-TES-14 SCP-1 SCP1
UniProtKB ID: Q15431, O14963, Q5VXJ6
Gene ID:
Mouse(20957) synaptonemal complex protein 1
Rat(25276) synaptonemal complex protein 1
Zebrafish(402797) synaptonemal complex protein 1
Horse(100065564) synaptonemal complex protein 1
domestic cat(101097877) synaptonemal complex protein 1
dog(606964) synaptonemal complex protein 1
chicken(772081) synaptonemal complex protein 1
naked mole-rat(101720568) synaptonemal complex protein 1
domestic guinea pig(100731973) synaptonemal complex protein 1
cow(525413) synaptonemal complex protein 1
sheep(101104025) synaptonemal complex protein 1
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003176 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102271 MISSION® esiRNA esiRNA human SYCP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003176 Rosetta Predictions human pricing
NM_012810 Rosetta Predictions rat pricing
NM_011516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335199 predicted 1809
2 SASI_Hs01_00164555 predicted 1283
3 SASI_Hs01_00164556 predicted 453
4 SASI_Hs01_00164557 predicted 1467
5 SASI_Hs01_00164558 predicted 747
6 SASI_Hs01_00164560 predicted 509
7 SASI_Hs02_00335200 predicted 1649
8 SASI_Hs02_00335201 predicted 1734
9 SASI_Hs01_00164561 predicted 841
10 SASI_Hs01_00164563 predicted 1003
11 SASI_Hs01_00164554 predicted 488
12 SASI_Hs01_00164559 predicted 840
13 SASI_Hs01_00164562 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260250 predicted 2926
2 SASI_Rn02_00260251 predicted 1742
3 SASI_Rn02_00260252 predicted 358
4 SASI_Rn02_00260253 predicted 2998
5 SASI_Rn02_00260254 predicted 917
6 SASI_Rn02_00260255 predicted 416
7 SASI_Rn02_00260256 predicted 1136
8 SASI_Rn02_00260257 predicted 1119
9 SASI_Rn02_00260258 predicted 1696
10 SASI_Rn02_00260259 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320833 predicted 1712
2 SASI_Mm01_00089536 predicted 1425
3 SASI_Mm01_00089537 predicted 1229
4 SASI_Mm01_00089539 predicted 351
5 SASI_Mm01_00089540 predicted 1269
6 SASI_Mm01_00089541 predicted 2977
7 SASI_Mm01_00089542 predicted 411
8 SASI_Mm01_00089543 predicted 1124
9 SASI_Mm01_00089544 predicted 1243
10 SASI_Mm02_00320834 predicted 1642
11 SASI_Mm01_00089538 predicted 430
12 SASI_Mm01_00089545 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011516
SYCP1 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-3033s1c1
Sequence:CCGGCCGTTGGACAACGATTGCTAACTCGAGTTAGCAATCGTTGTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-550s1c1
Sequence:CCGGGCCATTCAGGAACTTCAGTTTCTCGAGAAACTGAAGTTCCTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-2975s1c1
Sequence:CCGGCGCTATCAACTCCTGCATCTTCTCGAGAAGATGCAGGAGTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-1912s1c1
Sequence:CCGGGCTCGAAGCATTGAATGTGAACTCGAGTTCACATTCAATGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-1915s1c1
Sequence:CCGGCGAAGCATTGAATGTGAAGTTCTCGAGAACTTCACATTCAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011516
SYCP1 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-3033s1c1
Sequence:CCGGCCGTTGGACAACGATTGCTAACTCGAGTTAGCAATCGTTGTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-550s1c1
Sequence:CCGGGCCATTCAGGAACTTCAGTTTCTCGAGAAACTGAAGTTCCTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-2975s1c1
Sequence:CCGGCGCTATCAACTCCTGCATCTTCTCGAGAAGATGCAGGAGTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-1912s1c1
Sequence:CCGGGCTCGAAGCATTGAATGTGAACTCGAGTTCACATTCAATGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-1915s1c1
Sequence:CCGGCGAAGCATTGAATGTGAAGTTCTCGAGAACTTCACATTCAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011516
SYCP1 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-3033s1c1
Sequence:CCGGCCGTTGGACAACGATTGCTAACTCGAGTTAGCAATCGTTGTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-550s1c1
Sequence:CCGGGCCATTCAGGAACTTCAGTTTCTCGAGAAACTGAAGTTCCTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-2975s1c1
Sequence:CCGGCGCTATCAACTCCTGCATCTTCTCGAGAAGATGCAGGAGTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-1912s1c1
Sequence:CCGGGCTCGAAGCATTGAATGTGAACTCGAGTTCACATTCAATGCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011516.1-1915s1c1
Sequence:CCGGCGAAGCATTGAATGTGAAGTTCTCGAGAACTTCACATTCAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003176
SYCP1 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-1799s1c1
Sequence:CCGGCACACAGGAAACAAGTGATATCTCGAGATATCACTTGTTTCCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003176.2-3154s1c1
Sequence:CCGGGTGTAGTTAAGGAGCCTAATACTCGAGTATTAGGCTCCTTAACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-1007s1c1
Sequence:CCGGGCAGGTATCACTACTATTGATCTCGAGATCAATAGTAGTGATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003176.2-3165s1c1
Sequence:CCGGGAGCCTAATAACGTGAAACTTCTCGAGAAGTTTCACGTTATTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-360s1c1
Sequence:CCGGGCAAAGACTAATCTCTCCAAACTCGAGTTTGGAGAGATTAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-2470s1c1
Sequence:CCGGCCAATCTCAAAGCTGAACTTTCTCGAGAAAGTTCAGCTTTGAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-1768s1c1
Sequence:CCGGGCAACAAGCTTTCACTAGAAACTCGAGTTTCTAGTGAAAGCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-2656s1c1
Sequence:CCGGCTTCACAAACTGTATCTCGAACTCGAGTTCGAGATACAGTTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003176.2-2660s21c1
Sequence:CCGGACAAACTGTATCTCGAAATTTCTCGAGAAATTTCGAGATACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003176.2-2306s21c1
Sequence:CCGGTGATAAGCGATGTCAACATAACTCGAGTTATGTTGACATCGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003176.2-3155s21c1
Sequence:CCGGTGTAGTTAAGGAGCCTAATAACTCGAGTTATTAGGCTCCTTAACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003176
SYCP1 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-1799s1c1
Sequence:CCGGCACACAGGAAACAAGTGATATCTCGAGATATCACTTGTTTCCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003176.2-3154s1c1
Sequence:CCGGGTGTAGTTAAGGAGCCTAATACTCGAGTATTAGGCTCCTTAACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-1007s1c1
Sequence:CCGGGCAGGTATCACTACTATTGATCTCGAGATCAATAGTAGTGATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003176.2-3165s1c1
Sequence:CCGGGAGCCTAATAACGTGAAACTTCTCGAGAAGTTTCACGTTATTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-360s1c1
Sequence:CCGGGCAAAGACTAATCTCTCCAAACTCGAGTTTGGAGAGATTAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-2470s1c1
Sequence:CCGGCCAATCTCAAAGCTGAACTTTCTCGAGAAAGTTCAGCTTTGAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-1768s1c1
Sequence:CCGGGCAACAAGCTTTCACTAGAAACTCGAGTTTCTAGTGAAAGCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-2656s1c1
Sequence:CCGGCTTCACAAACTGTATCTCGAACTCGAGTTCGAGATACAGTTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003176.2-2660s21c1
Sequence:CCGGACAAACTGTATCTCGAAATTTCTCGAGAAATTTCGAGATACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003176.2-2306s21c1
Sequence:CCGGTGATAAGCGATGTCAACATAACTCGAGTTATGTTGACATCGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003176.2-3155s21c1
Sequence:CCGGTGTAGTTAAGGAGCCTAATAACTCGAGTTATTAGGCTCCTTAACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003176
SYCP1 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-1799s1c1
Sequence:CCGGCACACAGGAAACAAGTGATATCTCGAGATATCACTTGTTTCCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003176.2-3154s1c1
Sequence:CCGGGTGTAGTTAAGGAGCCTAATACTCGAGTATTAGGCTCCTTAACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-1007s1c1
Sequence:CCGGGCAGGTATCACTACTATTGATCTCGAGATCAATAGTAGTGATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003176.2-3165s1c1
Sequence:CCGGGAGCCTAATAACGTGAAACTTCTCGAGAAGTTTCACGTTATTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-360s1c1
Sequence:CCGGGCAAAGACTAATCTCTCCAAACTCGAGTTTGGAGAGATTAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-2470s1c1
Sequence:CCGGCCAATCTCAAAGCTGAACTTTCTCGAGAAAGTTCAGCTTTGAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003176.2-1768s1c1
Sequence:CCGGGCAACAAGCTTTCACTAGAAACTCGAGTTTCTAGTGAAAGCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003176.2-2656s1c1
Sequence:CCGGCTTCACAAACTGTATCTCGAACTCGAGTTCGAGATACAGTTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003176.2-2660s21c1
Sequence:CCGGACAAACTGTATCTCGAAATTTCTCGAGAAATTTCGAGATACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003176.2-2306s21c1
Sequence:CCGGTGATAAGCGATGTCAACATAACTCGAGTTATGTTGACATCGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003176.2-3155s21c1
Sequence:CCGGTGTAGTTAAGGAGCCTAATAACTCGAGTTATTAGGCTCCTTAACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks