EMAIL THIS PAGE TO A FRIEND

SYCP2

synaptonemal complex protein 2

Synonyms: SCP2
UniProtKB ID: Q9BX26, A2RUE5, O75763, Q5JX11, Q9NTX8, Q9UG27
Gene ID:
Human(10388) Summary: The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
Mouse(320558) synaptonemal complex protein 2
Rat(83820) synaptonemal complex protein 2
cow(784000) synaptonemal complex protein 2
sheep(101123486) synaptonemal complex protein 2
domestic guinea pig(100721297) synaptonemal complex protein 2
naked mole-rat(101723898) synaptonemal complex protein 2
Domestic Rabbit(100349362) synaptonemal complex protein 2
Zebrafish(557000) synaptonemal complex protein 2
chicken(419219) synaptonemal complex protein 2
domestic cat(101086965) synaptonemal complex protein 2
dog(477278) synaptonemal complex protein 2
239 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014258 Rosetta Predictions human pricing
NM_130735 Rosetta Predictions rat pricing
NM_177191 Rosetta Predictions mouse pricing
XM_619861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202137 predicted 3471
2 SASI_Hs01_00202138 predicted 1661
3 SASI_Hs01_00202139 predicted 2236
4 SASI_Hs01_00202140 predicted 901
5 SASI_Hs01_00202141 predicted 4194
6 SASI_Hs02_00345317 predicted 1736
7 SASI_Hs01_00202142 predicted 3432
8 SASI_Hs01_00202143 predicted 4230
9 SASI_Hs01_00202144 predicted 1692
10 SASI_Hs02_00345318 predicted 2042
11 SASI_Hs01_00202145 predicted 1891
12 SASI_Hs01_00202146 predicted 3975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089197 predicted 2256
2 SASI_Rn01_00089198 predicted 3798
3 SASI_Rn01_00089199 predicted 273
4 SASI_Rn02_00267460 predicted 4072
5 SASI_Rn01_00089200 predicted 2319
6 SASI_Rn02_00267461 predicted 3899
7 SASI_Rn01_00089201 predicted 2033
8 SASI_Rn01_00089202 predicted 4515
9 SASI_Rn01_00089203 predicted 3743
10 SASI_Rn01_00089205 predicted 2555
11 SASI_Rn01_00089204 predicted 292
12 SASI_Rn01_00089206 predicted 4502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347185 predicted 1335
2 SASI_Mm02_00347186 predicted 266
3 SASI_Mm02_00347187 predicted 2482
4 SASI_Mm02_00347188 predicted 2125
5 SASI_Mm02_00347189 predicted 3730
6 SASI_Mm02_00347190 predicted 2315
7 SASI_Mm02_00347191 predicted 4215
8 SASI_Mm02_00347192 predicted 2008
9 SASI_Mm02_00347193 predicted 288
10 SASI_Mm02_00347194 predicted 2538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273670 predicted 1755
2 SASI_Mm01_00273671 predicted 2331
3 SASI_Mm01_00273672 predicted 1988
4 SASI_Mm01_00273673 predicted 3588
5 SASI_Mm01_00273674 predicted 4329
6 SASI_Mm01_00273675 predicted 2174
7 SASI_Mm01_00273676 predicted 4066
8 SASI_Mm01_00273677 predicted 1868
9 SASI_Mm01_00273678 predicted 761
10 SASI_Mm01_00273679 predicted 2392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014258
SYCP2 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-2973s21c1
Sequence:CCGGATGACAGCAAGACTGATATTACTCGAGTAATATCAGTCTTGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-2334s21c1
Sequence:GTACCGGCAATTGAAGAATCGCTGATATCTCGAGATATCAGCGATTCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-397s21c1
Sequence:GTACCGGTGGACTTCTAACGATGATAAACTCGAGTTTATCATCGTTAGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-4346s21c1
Sequence:CCGGAGTCAGGACTCTAGGATTAAACTCGAGTTTAATCCTAGAGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014258.2-5284s21c1
Sequence:CCGGGCTACTACATTGCCTAAATATCTCGAGATATTTAGGCAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4830s1c1
Sequence:CCGGCCGAAGCAAGTGTACCCTTTACTCGAGTAAAGGGTACACTTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4920s1c1
Sequence:CCGGGCCCAGAAGACTTCTGTCTATCTCGAGATAGACAGAAGTCTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014258.2-4106s1c1
Sequence:CCGGGCAGATCATCATATCCACAAACTCGAGTTTGTGGATATGATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014258.2-3786s1c1
Sequence:CCGGGCTATTCAGATGTAAGCAGTTCTCGAGAACTGCTTACATCTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014258.2-3419s1c1
Sequence:CCGGCGAGATAATTGCCTTGACTTACTCGAGTAAGTCAAGGCAATTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014258.2-2316s1c1
Sequence:CCGGCGGTTCTCCTAAATAAGACAACTCGAGTTGTCTTATTTAGGAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4845s1c1
Sequence:CCGGCCTTTATAGGAACCCTCAAATCTCGAGATTTGAGGGTTCCTATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014258
SYCP2 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-2973s21c1
Sequence:CCGGATGACAGCAAGACTGATATTACTCGAGTAATATCAGTCTTGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-2334s21c1
Sequence:GTACCGGCAATTGAAGAATCGCTGATATCTCGAGATATCAGCGATTCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-397s21c1
Sequence:GTACCGGTGGACTTCTAACGATGATAAACTCGAGTTTATCATCGTTAGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-4346s21c1
Sequence:CCGGAGTCAGGACTCTAGGATTAAACTCGAGTTTAATCCTAGAGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014258.2-5284s21c1
Sequence:CCGGGCTACTACATTGCCTAAATATCTCGAGATATTTAGGCAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4830s1c1
Sequence:CCGGCCGAAGCAAGTGTACCCTTTACTCGAGTAAAGGGTACACTTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4920s1c1
Sequence:CCGGGCCCAGAAGACTTCTGTCTATCTCGAGATAGACAGAAGTCTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014258.2-4106s1c1
Sequence:CCGGGCAGATCATCATATCCACAAACTCGAGTTTGTGGATATGATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014258.2-3786s1c1
Sequence:CCGGGCTATTCAGATGTAAGCAGTTCTCGAGAACTGCTTACATCTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014258.2-3419s1c1
Sequence:CCGGCGAGATAATTGCCTTGACTTACTCGAGTAAGTCAAGGCAATTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014258.2-2316s1c1
Sequence:CCGGCGGTTCTCCTAAATAAGACAACTCGAGTTGTCTTATTTAGGAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4845s1c1
Sequence:CCGGCCTTTATAGGAACCCTCAAATCTCGAGATTTGAGGGTTCCTATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014258
SYCP2 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-2973s21c1
Sequence:CCGGATGACAGCAAGACTGATATTACTCGAGTAATATCAGTCTTGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-2334s21c1
Sequence:GTACCGGCAATTGAAGAATCGCTGATATCTCGAGATATCAGCGATTCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-397s21c1
Sequence:GTACCGGTGGACTTCTAACGATGATAAACTCGAGTTTATCATCGTTAGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014258.2-4346s21c1
Sequence:CCGGAGTCAGGACTCTAGGATTAAACTCGAGTTTAATCCTAGAGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014258.2-5284s21c1
Sequence:CCGGGCTACTACATTGCCTAAATATCTCGAGATATTTAGGCAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4830s1c1
Sequence:CCGGCCGAAGCAAGTGTACCCTTTACTCGAGTAAAGGGTACACTTGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4920s1c1
Sequence:CCGGGCCCAGAAGACTTCTGTCTATCTCGAGATAGACAGAAGTCTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014258.2-4106s1c1
Sequence:CCGGGCAGATCATCATATCCACAAACTCGAGTTTGTGGATATGATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014258.2-3786s1c1
Sequence:CCGGGCTATTCAGATGTAAGCAGTTCTCGAGAACTGCTTACATCTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014258.2-3419s1c1
Sequence:CCGGCGAGATAATTGCCTTGACTTACTCGAGTAAGTCAAGGCAATTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014258.2-2316s1c1
Sequence:CCGGCGGTTCTCCTAAATAAGACAACTCGAGTTGTCTTATTTAGGAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014258.2-4845s1c1
Sequence:CCGGCCTTTATAGGAACCCTCAAATCTCGAGATTTGAGGGTTCCTATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177191
SYCP2 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-1970s1c1
Sequence:CCGGCACCTGTAACAACTATCAAACCTCGAGGTTTGATAGTTGTTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-1282s1c1
Sequence:CCGGGAAATCACCAACGTGACTAAACTCGAGTTTAGTCACGTTGGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-4549s1c1
Sequence:CCGGCTACAAGACAAGCTACTTAAGCTCGAGCTTAAGTAGCTTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.2-1105s1c1
Sequence:CCGGGCTGTGACAACCATATGCAAACTCGAGTTTGCATATGGTTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177191.2-536s1c1
Sequence:CCGGGCCAACAAAGGAGGAGACTATCTCGAGATAGTCTCCTCCTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177191.2-2041s1c1
Sequence:CCGGGCATCATCTAAGCACCTCTATCTCGAGATAGAGGTGCTTAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177191.2-1912s1c1
Sequence:CCGGGCAGAGGACTACAGTCATTATCTCGAGATAATGACTGTAGTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177191.2-2511s1c1
Sequence:CCGGGCACCTGGTATTCACCTAATACTCGAGTATTAGGTGAATACCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177191
SYCP2 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-1970s1c1
Sequence:CCGGCACCTGTAACAACTATCAAACCTCGAGGTTTGATAGTTGTTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-1282s1c1
Sequence:CCGGGAAATCACCAACGTGACTAAACTCGAGTTTAGTCACGTTGGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-4549s1c1
Sequence:CCGGCTACAAGACAAGCTACTTAAGCTCGAGCTTAAGTAGCTTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.2-1105s1c1
Sequence:CCGGGCTGTGACAACCATATGCAAACTCGAGTTTGCATATGGTTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177191.2-536s1c1
Sequence:CCGGGCCAACAAAGGAGGAGACTATCTCGAGATAGTCTCCTCCTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177191.2-2041s1c1
Sequence:CCGGGCATCATCTAAGCACCTCTATCTCGAGATAGAGGTGCTTAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177191.2-1912s1c1
Sequence:CCGGGCAGAGGACTACAGTCATTATCTCGAGATAATGACTGTAGTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177191.2-2511s1c1
Sequence:CCGGGCACCTGGTATTCACCTAATACTCGAGTATTAGGTGAATACCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177191
SYCP2 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-1970s1c1
Sequence:CCGGCACCTGTAACAACTATCAAACCTCGAGGTTTGATAGTTGTTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-1282s1c1
Sequence:CCGGGAAATCACCAACGTGACTAAACTCGAGTTTAGTCACGTTGGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.3-4549s1c1
Sequence:CCGGCTACAAGACAAGCTACTTAAGCTCGAGCTTAAGTAGCTTGTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177191.2-1105s1c1
Sequence:CCGGGCTGTGACAACCATATGCAAACTCGAGTTTGCATATGGTTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177191.2-536s1c1
Sequence:CCGGGCCAACAAAGGAGGAGACTATCTCGAGATAGTCTCCTCCTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177191.2-2041s1c1
Sequence:CCGGGCATCATCTAAGCACCTCTATCTCGAGATAGAGGTGCTTAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177191.2-1912s1c1
Sequence:CCGGGCAGAGGACTACAGTCATTATCTCGAGATAATGACTGTAGTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177191.2-2511s1c1
Sequence:CCGGGCACCTGGTATTCACCTAATACTCGAGTATTAGGTGAATACCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks