EMAIL THIS PAGE TO A FRIEND

SYCP2L

synaptonemal complex protein 2-like

Synonyms: C6orf177 NO145 dJ62D2.1
UniProtKB ID: Q5T4T6, A6NDS5, Q08GK5, Q6ZRM2, Q96EJ2
Gene ID:
Mouse(637277) synaptonemal complex protein 2-like
Rat(364688) synaptonemal complex protein 2-like
chicken(771534) synaptonemal complex protein 2-like
domestic cat(101095414) synaptonemal complex protein 2-like
dog(609808) synaptonemal complex protein 2-like
naked mole-rat(101714492) synaptonemal complex protein 2-like
domestic guinea pig(100724094) synaptonemal complex protein 2-like
cow(509176) synaptonemal complex protein 2-like
sheep(101116873) synaptonemal complex protein 2-like
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA034679 Anti-SYCP2L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166411 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040274 Rosetta Predictions human pricing
XM_344581 Rosetta Predictions rat pricing
XM_001472337 Rosetta Predictions mouse pricing
XR_035591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052348 predicted 1483
2 SASI_Hs01_00052349 predicted 2389
3 SASI_Hs01_00052350 predicted 2248
4 SASI_Hs02_00308924 predicted 652
5 SASI_Hs01_00052351 predicted 2592
6 SASI_Hs01_00052353 predicted 487
7 SASI_Hs01_00052355 predicted 2791
8 SASI_Hs01_00052356 predicted 946
9 SASI_Hs01_00052357 predicted 1397
10 SASI_Hs02_00308925 predicted 1049
11 SASI_Hs01_00052352 predicted 1468
12 SASI_Hs01_00052354 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397280 predicted 1273
2 SASI_Rn02_00397281 predicted 304
3 SASI_Rn02_00397282 predicted 758
4 SASI_Rn02_00397283 predicted 1443
5 SASI_Rn02_00397284 predicted 990
6 SASI_Rn02_00397285 predicted 1073
7 SASI_Rn02_00397286 predicted 859
8 SASI_Rn02_00397287 predicted 1187
9 SASI_Rn02_00397288 predicted 1474
10 SASI_Rn02_00397289 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00360834 predicted 1367
2 SASI_Mm02_00360835 predicted 2042
3 SASI_Mm02_00360836 predicted 736
4 SASI_Mm02_00360837 predicted 1444
5 SASI_Mm02_00360838 predicted 1053
6 SASI_Mm02_00360839 predicted 2280
7 SASI_Mm02_00360840 predicted 1482
8 SASI_Mm02_00360841 predicted 967
9 SASI_Mm02_00360842 predicted 1598
10 SASI_Mm02_00360843 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00483408 predicted 1330
2 SASI_Mm02_00483409 predicted 1624
3 SASI_Mm02_00483410 predicted 698
4 SASI_Mm02_00483411 predicted 674
5 SASI_Mm02_00483412 predicted 1426
6 SASI_Mm02_00483413 predicted 1010
7 SASI_Mm02_00483414 predicted 1840
8 SASI_Mm02_00483415 predicted 931
9 SASI_Mm02_00483416 predicted 398
10 SASI_Mm02_00483417 predicted 1345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166411
SYCP2L MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex protein 2-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_166411.2-2185s1c1
Sequence:CCGGCGTGCTCTGTACGCATTCAATCTCGAGATTGAATGCGTACAGAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-1010s1c1
Sequence:CCGGGCCTAATAACTCTCCACTTAACTCGAGTTAAGTGGAGAGTTATTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-1572s1c1
Sequence:CCGGGCTGAGAAACTTGGAAGACAACTCGAGTTGTCTTCCAAGTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-424s1c1
Sequence:CCGGCGAGAATTTGAGACGTTTATACTCGAGTATAAACGTCTCAAATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-754s1c1
Sequence:CCGGCCCATGATTATCAGCTACAAACTCGAGTTTGTAGCTGATAATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166411
SYCP2L MISSION shRNA shRNA Plasmid DNA
synaptonemal complex protein 2-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_166411.2-2185s1c1
Sequence:CCGGCGTGCTCTGTACGCATTCAATCTCGAGATTGAATGCGTACAGAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-1010s1c1
Sequence:CCGGGCCTAATAACTCTCCACTTAACTCGAGTTAAGTGGAGAGTTATTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-1572s1c1
Sequence:CCGGGCTGAGAAACTTGGAAGACAACTCGAGTTGTCTTCCAAGTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-424s1c1
Sequence:CCGGCGAGAATTTGAGACGTTTATACTCGAGTATAAACGTCTCAAATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-754s1c1
Sequence:CCGGCCCATGATTATCAGCTACAAACTCGAGTTTGTAGCTGATAATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166411
SYCP2L MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex protein 2-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_166411.2-2185s1c1
Sequence:CCGGCGTGCTCTGTACGCATTCAATCTCGAGATTGAATGCGTACAGAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-1010s1c1
Sequence:CCGGGCCTAATAACTCTCCACTTAACTCGAGTTAAGTGGAGAGTTATTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-1572s1c1
Sequence:CCGGGCTGAGAAACTTGGAAGACAACTCGAGTTGTCTTCCAAGTTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-424s1c1
Sequence:CCGGCGAGAATTTGAGACGTTTATACTCGAGTATAAACGTCTCAAATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166411.2-754s1c1
Sequence:CCGGCCCATGATTATCAGCTACAAACTCGAGTTTGTAGCTGATAATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks