EMAIL THIS PAGE TO A FRIEND

SYCP3

synaptonemal complex protein 3

Synonyms: COR1 SCP3 SPGF4
UniProtKB ID: Q8IZU3
Gene ID:
Human(50511) Summary: This gene encodes an essential structural component of the synaptonemal complex. This complex is involved in synapsis, recombination and segregation of meiotic chromosomes. Mutations in this gene are associated with azoospermia in males and susceptibility to pregnancy loss in females. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, May 2010]
Mouse(20962) synaptonemal complex protein 3
Rat(25561) synaptonemal complex protein 3
cow(615896) synaptonemal complex protein 3
sheep(101108560) synaptonemal complex protein 3
domestic guinea pig(101787294) synaptonemal complex protein 3
naked mole-rat(101711639) synaptonemal complex protein 3
Zebrafish(678602) synaptonemal complex protein 3
domestic cat(101099735) synaptonemal complex protein 3
dog(100684357) synaptonemal complex protein 3
chicken(418097) synaptonemal complex protein 3
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153694 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153694 Rosetta Predictions human pricing
NM_013041 Rosetta Predictions rat pricing
NM_011517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045519 predicted 354
2 SASI_Hs01_00045520 predicted 389
3 SASI_Hs01_00045521 predicted 261
4 SASI_Hs01_00045522 predicted 301
5 SASI_Hs02_00367406 predicted 378
6 SASI_Hs01_00045525 predicted 236
7 SASI_Hs01_00045526 predicted 399
8 SASI_Hs01_00045527 predicted 492
9 SASI_Hs02_00367407 predicted 485
10 SASI_Hs02_00367408 predicted 264
11 SASI_Hs01_00045523 predicted 243
12 SASI_Hs01_00045524 predicted 514
13 SASI_Hs01_00045528 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091309 predicted 222
2 SASI_Rn01_00091310 predicted 192
3 SASI_Rn01_00091311 predicted 524
4 SASI_Rn01_00091312 predicted 201
5 SASI_Rn01_00091314 predicted 478
6 SASI_Rn01_00091315 predicted 312
7 SASI_Rn01_00091316 predicted 207
8 SASI_Rn01_00091317 predicted 292
9 SASI_Rn01_00091318 predicted 526
10 SASI_Rn02_00260757 predicted 526
11 SASI_Rn01_00091313 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129457 predicted 218
2 SASI_Mm01_00129458 predicted 283
3 SASI_Mm01_00129459 predicted 317
4 SASI_Mm01_00129460 predicted 242
5 SASI_Mm01_00129461 predicted 219
6 SASI_Mm01_00129462 predicted 430
7 SASI_Mm01_00129463 predicted 240
8 SASI_Mm01_00129464 predicted 487
9 SASI_Mm01_00129466 predicted 340
10 SASI_Mm02_00320835 predicted 538
11 SASI_Mm01_00129465 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153694
SYCP3 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153694.2-362s1c1
Sequence:CCGGGTATACCAAGGCTTCTCTCAACTCGAGTTGAGAGAAGCCTTGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-150s1c1
Sequence:CCGGGCCTATGACTTTGAGACTGAACTCGAGTTCAGTCTCAAAGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-315s1c1
Sequence:CCGGGTTGACATTAACAAGGCTCTTCTCGAGAAGAGCCTTGTTAATGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-135s1c1
Sequence:CCGGGATCAGTTTACGAGAGCCTATCTCGAGATAGGCTCTCGTAAACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-171s1c1
Sequence:CCGGGATAAGAAAGATCTGAGTGGACTCGAGTCCACTCAGATCTTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-446s1c1
Sequence:CCGGCCAAGAATATTCTCAGCAGTTCTCGAGAACTGCTGAGAATATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-860s21c1
Sequence:CCGGGAACTTGAACCTAAGTAATATCTCGAGATATTACTTAGGTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-884s21c1
Sequence:CCGGACAATTATAACGTTAGCTAAGCTCGAGCTTAGCTAACGTTATAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-945s21c1
Sequence:CCGGCTTTAATCATAAACCTGTTTCCTCGAGGAAACAGGTTTATGATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153694.3-269s21c1
Sequence:CCGGAGACTGCAGTCATTGAGAAACCTCGAGGTTTCTCAATGACTGCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153694
SYCP3 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153694.2-362s1c1
Sequence:CCGGGTATACCAAGGCTTCTCTCAACTCGAGTTGAGAGAAGCCTTGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-150s1c1
Sequence:CCGGGCCTATGACTTTGAGACTGAACTCGAGTTCAGTCTCAAAGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-315s1c1
Sequence:CCGGGTTGACATTAACAAGGCTCTTCTCGAGAAGAGCCTTGTTAATGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-135s1c1
Sequence:CCGGGATCAGTTTACGAGAGCCTATCTCGAGATAGGCTCTCGTAAACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-171s1c1
Sequence:CCGGGATAAGAAAGATCTGAGTGGACTCGAGTCCACTCAGATCTTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-446s1c1
Sequence:CCGGCCAAGAATATTCTCAGCAGTTCTCGAGAACTGCTGAGAATATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-860s21c1
Sequence:CCGGGAACTTGAACCTAAGTAATATCTCGAGATATTACTTAGGTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-884s21c1
Sequence:CCGGACAATTATAACGTTAGCTAAGCTCGAGCTTAGCTAACGTTATAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-945s21c1
Sequence:CCGGCTTTAATCATAAACCTGTTTCCTCGAGGAAACAGGTTTATGATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153694.3-269s21c1
Sequence:CCGGAGACTGCAGTCATTGAGAAACCTCGAGGTTTCTCAATGACTGCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153694
SYCP3 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153694.2-362s1c1
Sequence:CCGGGTATACCAAGGCTTCTCTCAACTCGAGTTGAGAGAAGCCTTGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-150s1c1
Sequence:CCGGGCCTATGACTTTGAGACTGAACTCGAGTTCAGTCTCAAAGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-315s1c1
Sequence:CCGGGTTGACATTAACAAGGCTCTTCTCGAGAAGAGCCTTGTTAATGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-135s1c1
Sequence:CCGGGATCAGTTTACGAGAGCCTATCTCGAGATAGGCTCTCGTAAACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-171s1c1
Sequence:CCGGGATAAGAAAGATCTGAGTGGACTCGAGTCCACTCAGATCTTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153694.2-446s1c1
Sequence:CCGGCCAAGAATATTCTCAGCAGTTCTCGAGAACTGCTGAGAATATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-860s21c1
Sequence:CCGGGAACTTGAACCTAAGTAATATCTCGAGATATTACTTAGGTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-884s21c1
Sequence:CCGGACAATTATAACGTTAGCTAAGCTCGAGCTTAGCTAACGTTATAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153694.3-945s21c1
Sequence:CCGGCTTTAATCATAAACCTGTTTCCTCGAGGAAACAGGTTTATGATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153694.3-269s21c1
Sequence:CCGGAGACTGCAGTCATTGAGAAACCTCGAGGTTTCTCAATGACTGCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011517
SYCP3 MISSION shRNA Bacterial Glycerol Stock
synaptonemal complex protein 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-679s1c1
Sequence:CCGGCGAGCAGTTCATAAAGAGTTTCTCGAGAAACTCTTTATGAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-127s1c1
Sequence:CCGGGCCGCTGAGCAAACATCTAAACTCGAGTTTAGATGTTTGCTCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-649s1c1
Sequence:CCGGCCAGAGAATGTTTGCAATGAACTCGAGTTCATTGCAAACATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-284s1c1
Sequence:CCGGGCTCCAGTAATTGATAAACATCTCGAGATGTTTATCAATTACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011517.1-855s1c1
Sequence:CCGGGAGTCTTTGAAGAAAGAACTTCTCGAGAAGTTCTTTCTTCAAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011517.2-503s21c1
Sequence:CCGGGAATATTCTCAGCAATTTATGCTCGAGCATAAATTGCTGAGAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011517.2-728s21c1
Sequence:CCGGGGCACACAAAGTGAACTTAAACTCGAGTTTAAGTTCACTTTGTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011517
SYCP3 MISSION shRNA shRNA Plasmid DNA
synaptonemal complex protein 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-679s1c1
Sequence:CCGGCGAGCAGTTCATAAAGAGTTTCTCGAGAAACTCTTTATGAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-127s1c1
Sequence:CCGGGCCGCTGAGCAAACATCTAAACTCGAGTTTAGATGTTTGCTCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-649s1c1
Sequence:CCGGCCAGAGAATGTTTGCAATGAACTCGAGTTCATTGCAAACATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-284s1c1
Sequence:CCGGGCTCCAGTAATTGATAAACATCTCGAGATGTTTATCAATTACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011517.1-855s1c1
Sequence:CCGGGAGTCTTTGAAGAAAGAACTTCTCGAGAAGTTCTTTCTTCAAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011517.2-503s21c1
Sequence:CCGGGAATATTCTCAGCAATTTATGCTCGAGCATAAATTGCTGAGAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011517.2-728s21c1
Sequence:CCGGGGCACACAAAGTGAACTTAAACTCGAGTTTAAGTTCACTTTGTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011517
SYCP3 MISSION shRNA Lentiviral Transduction Particles
synaptonemal complex protein 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-679s1c1
Sequence:CCGGCGAGCAGTTCATAAAGAGTTTCTCGAGAAACTCTTTATGAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-127s1c1
Sequence:CCGGGCCGCTGAGCAAACATCTAAACTCGAGTTTAGATGTTTGCTCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-649s1c1
Sequence:CCGGCCAGAGAATGTTTGCAATGAACTCGAGTTCATTGCAAACATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011517.1-284s1c1
Sequence:CCGGGCTCCAGTAATTGATAAACATCTCGAGATGTTTATCAATTACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011517.1-855s1c1
Sequence:CCGGGAGTCTTTGAAGAAAGAACTTCTCGAGAAGTTCTTTCTTCAAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011517.2-503s21c1
Sequence:CCGGGAATATTCTCAGCAATTTATGCTCGAGCATAAATTGCTGAGAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011517.2-728s21c1
Sequence:CCGGGGCACACAAAGTGAACTTAAACTCGAGTTTAAGTTCACTTTGTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks