EMAIL THIS PAGE TO A FRIEND

SYDE1

synapse defective 1, Rho GTPase, homolog 1 (C. elegans)

Synonyms: 7h3
UniProtKB ID: Q6ZW31, Q7L2I8, Q8N6J2, Q9H8K4
Gene ID:
Mouse(71709) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Rat(362842) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
chicken(429892) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Horse(100062995) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
domestic cat(101087974) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
dog(484870) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
naked mole-rat(101721858) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
domestic guinea pig(100716309) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
cow(789472) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
sheep(101102234) synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_359260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_359260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_359260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033025 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033025 Rosetta Predictions human pricing
XM_001077806 Rosetta Predictions rat pricing
XM_343173 Rosetta Predictions rat pricing
XM_359260 Rosetta Predictions mouse pricing
XM_903544 Rosetta Predictions mouse pricing
XM_909679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119247 predicted 2145
2 SASI_Hs01_00119248 predicted 2197
3 SASI_Hs01_00119249 predicted 2375
4 SASI_Hs01_00119250 predicted 1445
5 SASI_Hs01_00119251 predicted 1383
6 SASI_Hs01_00119252 predicted 2409
7 SASI_Hs01_00119253 predicted 1995
8 SASI_Hs01_00119254 predicted 2643
9 SASI_Hs01_00119255 predicted 958
10 SASI_Hs01_00119256 predicted 2653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358592 predicted 1608
2 SASI_Rn02_00358593 predicted 1951
3 SASI_Rn02_00358594 predicted 1128
4 SASI_Rn02_00358595 predicted 2496
5 SASI_Rn02_00358596 predicted 1411
6 SASI_Rn02_00358597 predicted 2048
7 SASI_Rn02_00358598 predicted 2319
8 SASI_Rn02_00358599 predicted 747
9 SASI_Rn02_00358600 predicted 479
10 SASI_Rn02_00358601 predicted 2380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395413 predicted 1484
2 SASI_Rn02_00395414 predicted 1828
3 SASI_Rn02_00395415 predicted 1005
4 SASI_Rn02_00395416 predicted 2372
5 SASI_Rn02_00395417 predicted 1287
6 SASI_Rn02_00395418 predicted 1917
7 SASI_Rn02_00395419 predicted 2191
8 SASI_Rn02_00395420 predicted 620
9 SASI_Rn02_00395421 predicted 350
10 SASI_Rn02_00395422 predicted 2245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_359260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266534 predicted 1194
2 SASI_Mm01_00266535 predicted 1117
3 SASI_Mm01_00266536 predicted 1454
4 SASI_Mm01_00266537 predicted 2102
5 SASI_Mm01_00266538 predicted 678
6 SASI_Mm01_00266539 predicted 1822
7 SASI_Mm01_00266540 predicted 1839
8 SASI_Mm01_00266541 predicted 1187
9 SASI_Mm01_00266542 predicted 996
10 SASI_Mm01_00266543 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430411 predicted 1189
2 SASI_Mm02_00430412 predicted 1118
3 SASI_Mm02_00430413 predicted 1447
4 SASI_Mm02_00430414 predicted 2108
5 SASI_Mm02_00430415 predicted 675
6 SASI_Mm02_00430416 predicted 1827
7 SASI_Mm02_00430417 predicted 1831
8 SASI_Mm02_00430418 predicted 1188
9 SASI_Mm02_00430419 predicted 1001
10 SASI_Mm02_00430420 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434996 predicted 1191
2 SASI_Mm02_00434997 predicted 1123
3 SASI_Mm02_00434998 predicted 1451
4 SASI_Mm02_00434999 predicted 2100
5 SASI_Mm02_00435000 predicted 674
6 SASI_Mm02_00435001 predicted 1825
7 SASI_Mm02_00435002 predicted 1832
8 SASI_Mm02_00435003 predicted 1184
9 SASI_Mm02_00435004 predicted 996
10 SASI_Mm02_00435005 predicted 1452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_359260
VALIDATED
SYDE1 MISSION shRNA Bacterial Glycerol Stock
synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-2744s1c1
Sequence:CCGGCCCTCCCTTGAAGTATCTAAACTCGAGTTTAGATACTTCAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-101s1c1
Sequence:CCGGGTCGTGAGAAACTTCCTCGAACTCGAGTTCGAGGAAGTTTCTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-1175s1c1
Sequence:CCGGGACTTCTTTACGCCAAGCTAACTCGAGTTAGCTTGGCGTAAAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-1900s1c1
Sequence:CCGGGCACCGTATTTGAGGCCCAAACTCGAGTTTGGGCCTCAAATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-2191s1c1
Sequence:CCGGCACCTGAATCTCAAAGACTTTCTCGAGAAAGTCTTTGAGATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_359260
VALIDATED
SYDE1 MISSION shRNA shRNA Plasmid DNA
synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-2744s1c1
Sequence:CCGGCCCTCCCTTGAAGTATCTAAACTCGAGTTTAGATACTTCAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-101s1c1
Sequence:CCGGGTCGTGAGAAACTTCCTCGAACTCGAGTTCGAGGAAGTTTCTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-1175s1c1
Sequence:CCGGGACTTCTTTACGCCAAGCTAACTCGAGTTAGCTTGGCGTAAAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-1900s1c1
Sequence:CCGGGCACCGTATTTGAGGCCCAAACTCGAGTTTGGGCCTCAAATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-2191s1c1
Sequence:CCGGCACCTGAATCTCAAAGACTTTCTCGAGAAAGTCTTTGAGATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_359260
VALIDATED
SYDE1 MISSION shRNA Lentiviral Transduction Particles
synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-2744s1c1
Sequence:CCGGCCCTCCCTTGAAGTATCTAAACTCGAGTTTAGATACTTCAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-101s1c1
Sequence:CCGGGTCGTGAGAAACTTCCTCGAACTCGAGTTCGAGGAAGTTTCTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-1175s1c1
Sequence:CCGGGACTTCTTTACGCCAAGCTAACTCGAGTTAGCTTGGCGTAAAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-1900s1c1
Sequence:CCGGGCACCGTATTTGAGGCCCAAACTCGAGTTTGGGCCTCAAATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359260.1-2191s1c1
Sequence:CCGGCACCTGAATCTCAAAGACTTTCTCGAGAAAGTCTTTGAGATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033025
SYDE1 MISSION shRNA Bacterial Glycerol Stock
synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-529s1c1
Sequence:CCGGCTCCATAAAGATGAAGAAGCTCTCGAGAGCTTCTTCATCTTTATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-1456s1c1
Sequence:CCGGCAAGGATTATCTTCGAGAGTTCTCGAGAACTCTCGAAGATAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033025.4-2387s1c1
Sequence:CCGGGCTGAGACTCATTCCCAGTTTCTCGAGAAACTGGGAATGAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033025.4-2638s1c1
Sequence:CCGGGCTGCCAACCAAATCAGTATTCTCGAGAATACTGATTTGGTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-2158s1c1
Sequence:CCGGGCACCTGAATCTCAAAGACTTCTCGAGAAGTCTTTGAGATTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033025
SYDE1 MISSION shRNA shRNA Plasmid DNA
synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-529s1c1
Sequence:CCGGCTCCATAAAGATGAAGAAGCTCTCGAGAGCTTCTTCATCTTTATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-1456s1c1
Sequence:CCGGCAAGGATTATCTTCGAGAGTTCTCGAGAACTCTCGAAGATAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033025.4-2387s1c1
Sequence:CCGGGCTGAGACTCATTCCCAGTTTCTCGAGAAACTGGGAATGAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033025.4-2638s1c1
Sequence:CCGGGCTGCCAACCAAATCAGTATTCTCGAGAATACTGATTTGGTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-2158s1c1
Sequence:CCGGGCACCTGAATCTCAAAGACTTCTCGAGAAGTCTTTGAGATTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033025
SYDE1 MISSION shRNA Lentiviral Transduction Particles
synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-529s1c1
Sequence:CCGGCTCCATAAAGATGAAGAAGCTCTCGAGAGCTTCTTCATCTTTATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-1456s1c1
Sequence:CCGGCAAGGATTATCTTCGAGAGTTCTCGAGAACTCTCGAAGATAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033025.4-2387s1c1
Sequence:CCGGGCTGAGACTCATTCCCAGTTTCTCGAGAAACTGGGAATGAGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033025.4-2638s1c1
Sequence:CCGGGCTGCCAACCAAATCAGTATTCTCGAGAATACTGATTTGGTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033025.4-2158s1c1
Sequence:CCGGGCACCTGAATCTCAAAGACTTCTCGAGAAGTCTTTGAGATTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks