EMAIL THIS PAGE TO A FRIEND

SYDE2

synapse defective 1, Rho GTPase, homolog 2 (C. elegans)

Synonyms: RP11-33E12.1
UniProtKB ID: Q5VT97, Q5VT96, Q8NDB8, Q9H8A6
Gene ID:
Mouse(214804) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
Rat(308021) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
cow(524536) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
sheep(101112609) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
domestic guinea pig(100730311) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
naked mole-rat(101714114) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
chicken(424530) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
dog(490184) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
domestic cat(101092200) synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032184 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032184 Rosetta Predictions human pricing
XM_086186 Rosetta Predictions human pricing
XM_217680 Rosetta Predictions rat pricing
XR_009288 Rosetta Predictions rat pricing
XM_001004384 Rosetta Predictions mouse pricing
XM_001479228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359456 predicted 2890
2 SASI_Hs02_00359457 predicted 2263
3 SASI_Hs02_00359458 predicted 2589
4 SASI_Hs02_00359459 predicted 2345
5 SASI_Hs02_00359460 predicted 3282
6 SASI_Hs02_00359461 predicted 1942
7 SASI_Hs02_00359462 predicted 3023
8 SASI_Hs02_00359463 predicted 3181
9 SASI_Hs02_00359464 predicted 2388
10 SASI_Hs02_00359465 predicted 2898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_086186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269343 predicted 3432
2 SASI_Hs01_00269344 predicted 2803
3 SASI_Hs01_00269345 predicted 3138
4 SASI_Hs01_00269346 predicted 2896
5 SASI_Hs01_00269347 predicted 3827
6 SASI_Hs01_00269348 predicted 3578
7 SASI_Hs01_00269349 predicted 2941
8 SASI_Hs01_00269350 predicted 2653
9 SASI_Hs01_00269351 predicted 1428
10 SASI_Hs01_00269352 predicted 3454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377307 predicted 1584
2 SASI_Rn02_00377308 predicted 1131
3 SASI_Rn02_00377309 predicted 1639
4 SASI_Rn02_00377310 predicted 3402
5 SASI_Rn02_00377311 predicted 2139
6 SASI_Rn02_00377312 predicted 1053
7 SASI_Rn02_00377313 predicted 1294
8 SASI_Rn02_00377314 predicted 3573
9 SASI_Rn02_00377315 predicted 1574
10 SASI_Rn02_00377316 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180454 predicted 1580
2 SASI_Rn01_00180455 predicted 1123
3 SASI_Rn02_00419303 predicted 1634
4 SASI_Rn01_00180458 predicted 3394
5 SASI_Rn01_00180459 predicted 2137
6 SASI_Rn01_00180460 predicted 1042
7 SASI_Rn01_00180461 predicted 1289
8 SASI_Rn02_00419304 predicted 3577
9 SASI_Rn01_00180463 predicted 1569
10 SASI_Rn02_00419305 predicted 966
11 SASI_Rn01_00180456 predicted 2205
12 SASI_Rn01_00180457 predicted 307
13 SASI_Rn01_00180462 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231967 predicted 1257
2 SASI_Mm01_00231968 predicted 2116
3 SASI_Mm01_00231969 predicted 1714
4 SASI_Mm02_00356250 predicted 2899
5 SASI_Mm01_00231972 predicted 1279
6 SASI_Mm01_00231973 predicted 3756
7 SASI_Mm01_00231975 predicted 3504
8 SASI_Mm02_00356251 predicted 1167
9 SASI_Mm01_00231976 predicted 1777
10 SASI_Mm02_00356252 predicted 2468
11 SASI_Mm01_00231970 predicted 220
12 SASI_Mm01_00231971 predicted 476
13 SASI_Mm01_00231974 predicted 2156
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00408529 predicted 1883
2 SASI_Mm02_00408530 predicted 2746
3 SASI_Mm02_00408531 predicted 2344
4 SASI_Mm02_00408532 predicted 486
5 SASI_Mm02_00408533 predicted 3524
6 SASI_Mm02_00408534 predicted 1902
7 SASI_Mm02_00408535 predicted 4380
8 SASI_Mm02_00408536 predicted 4126
9 SASI_Mm02_00408537 predicted 1787
10 SASI_Mm02_00408538 predicted 3091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032184
VALIDATED
SYDE2 MISSION shRNA Bacterial Glycerol Stock
synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-1667s21c1
Sequence:CCGGAGCCGAAAGCTAAGCGTTAAGCTCGAGCTTAACGCTTAGCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-2595s21c1
Sequence:CCGGTAGTAGGCCTGTATCGATTATCTCGAGATAATCGATACAGGCCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032184.1-1326s21c1
Sequence:CCGGCCGAACATGCAGGTGATATTCCTCGAGGAATATCACCTGCATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-3842s21c1
Sequence:CCGGCTTGGACTTCTTGGGATATTTCTCGAGAAATATCCCAAGAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-2719s21c1
Sequence:CCGGAGGTGTTCTTAAGGATTATTTCTCGAGAAATAATCCTTAAGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032184
VALIDATED
SYDE2 MISSION shRNA shRNA Plasmid DNA
synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-1667s21c1
Sequence:CCGGAGCCGAAAGCTAAGCGTTAAGCTCGAGCTTAACGCTTAGCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-2595s21c1
Sequence:CCGGTAGTAGGCCTGTATCGATTATCTCGAGATAATCGATACAGGCCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032184.1-1326s21c1
Sequence:CCGGCCGAACATGCAGGTGATATTCCTCGAGGAATATCACCTGCATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-3842s21c1
Sequence:CCGGCTTGGACTTCTTGGGATATTTCTCGAGAAATATCCCAAGAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-2719s21c1
Sequence:CCGGAGGTGTTCTTAAGGATTATTTCTCGAGAAATAATCCTTAAGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032184
VALIDATED
SYDE2 MISSION shRNA Lentiviral Transduction Particles
synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-1667s21c1
Sequence:CCGGAGCCGAAAGCTAAGCGTTAAGCTCGAGCTTAACGCTTAGCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-2595s21c1
Sequence:CCGGTAGTAGGCCTGTATCGATTATCTCGAGATAATCGATACAGGCCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032184.1-1326s21c1
Sequence:CCGGCCGAACATGCAGGTGATATTCCTCGAGGAATATCACCTGCATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-3842s21c1
Sequence:CCGGCTTGGACTTCTTGGGATATTTCTCGAGAAATATCCCAAGAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032184.1-2719s21c1
Sequence:CCGGAGGTGTTCTTAAGGATTATTTCTCGAGAAATAATCCTTAAGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks