EMAIL THIS PAGE TO A FRIEND

SYF2

SYF2 pre-mRNA-splicing factor

Synonyms: CBPIN NTC31 P29 fSAP29
UniProtKB ID: O95926, Q5TH73
Gene ID:
Human(25949) Summary: This gene encodes a nuclear protein that interacts with cyclin D-type binding-protein 1, which is thought to be a cell cycle regulator at the G1/S transition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(68592) SYF2 homolog, RNA splicing factor (S. cerevisiae)
Rat(170933) SYF2 homolog, RNA splicing factor (S. cerevisiae)
Zebrafish(445043) SYF2 homolog, RNA splicing factor (S. cerevisiae)
chicken(419593) SYF2 homolog, RNA splicing factor (S. cerevisiae)
domestic cat(101080723) SYF2 homolog, RNA splicing factor (S. cerevisiae)
dog(478184) SYF2 homolog, RNA splicing factor (S. cerevisiae)
naked mole-rat(101696385) SYF2 homolog, RNA splicing factor (S. cerevisiae)
domestic guinea pig(100718492) SYF2 homolog, RNA splicing factor (S. cerevisiae)
cow(522372) SYF2 homolog, RNA splicing factor (S. cerevisiae)
sheep(101119379) SYF2 homolog, RNA splicing factor (S. cerevisiae)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015484 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098321 MISSION® esiRNA esiRNA human SYF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015484 Rosetta Predictions human pricing
NM_207170 Rosetta Predictions human pricing
NM_133417 Rosetta Predictions rat pricing
NM_026780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131427 predicted 937
2 SASI_Hs01_00131428 predicted 772
3 SASI_Hs01_00131430 predicted 926
4 SASI_Hs02_00347937 predicted 667
5 SASI_Hs01_00131432 predicted 785
6 SASI_Hs01_00131433 predicted 655
7 SASI_Hs02_00347938 predicted 1010
8 SASI_Hs01_00131435 predicted 1067
9 SASI_Hs01_00131436 predicted 863
10 SASI_Hs02_00347939 predicted 533
11 SASI_Hs01_00131429 predicted 679
12 SASI_Hs01_00131431 predicted 1016
13 SASI_Hs01_00131434 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190297 predicted 807
2 SASI_Hs01_00190298 predicted 646
3 SASI_Hs01_00190300 predicted 791
4 SASI_Hs02_00373794 predicted 544
5 SASI_Hs01_00190302 predicted 659
6 SASI_Hs01_00190303 predicted 527
7 SASI_Hs02_00373795 predicted 885
8 SASI_Hs01_00190305 predicted 933
9 SASI_Hs01_00190306 predicted 741
10 SASI_Hs02_00373796 predicted 411
11 SASI_Hs01_00190299 predicted 561
12 SASI_Hs01_00190301 predicted 892
13 SASI_Hs01_00190304 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056191 predicted 674
2 SASI_Rn01_00056192 predicted 921
3 SASI_Rn02_00267673 predicted 922
4 SASI_Rn01_00056193 predicted 852
5 SASI_Rn01_00056194 predicted 818
6 SASI_Rn01_00056195 predicted 629
7 SASI_Rn01_00056197 predicted 209
8 SASI_Rn01_00056198 predicted 962
9 SASI_Rn02_00267674 predicted 544
10 SASI_Rn01_00056199 predicted 611
11 SASI_Rn01_00056196 predicted 975
12 SASI_Rn01_00056200 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171994 predicted 670
2 SASI_Mm01_00171995 predicted 970
3 SASI_Mm01_00171996 predicted 923
4 SASI_Mm01_00171997 predicted 613
5 SASI_Mm01_00171998 predicted 759
6 SASI_Mm01_00171999 predicted 982
7 SASI_Mm01_00172000 predicted 922
8 SASI_Mm01_00172001 predicted 860
9 SASI_Mm01_00172002 predicted 788
10 SASI_Mm01_00172003 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015484
VALIDATED
SYF2 MISSION shRNA Bacterial Glycerol Stock
SYF2 pre-mRNA-splicing factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-185s21c1
Sequence:CCGGCGGAATGAAGCTCGTAAATTACTCGAGTAATTTACGAGCTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015484.4-644s21c1
Sequence:CCGGAGCCGGAGACGTCCTTATAATCTCGAGATTATAAGGACGTCTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-926s21c1
Sequence:CCGGTGTGGTTTCTTAAACGTATATCTCGAGATATACGTTTAAGAAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-465s21c1
Sequence:CCGGGGTTGACCAAGCAGATCAAACCTCGAGGTTTGATCTGCTTGGTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-144s21c1
Sequence:CCGGGCGAACAGAGACTGCGCAAATCTCGAGATTTGCGCAGTCTCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015484.2-1064s1c1
Sequence:CCGGGCTGTTTAATCTTTGAAGCATCTCGAGATGCTTCAAAGATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-172s1c1
Sequence:CCGGTGCGGAATGAAGCTCGTAAATCTCGAGATTTACGAGCTTCATTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-173s1c1
Sequence:CCGGGCGGAATGAAGCTCGTAAATTCTCGAGAATTTACGAGCTTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-645s1c1
Sequence:CCGGCCTTATAATGATGATGCAGATCTCGAGATCTGCATCATCATTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-186s1c1
Sequence:CCGGCGTAAATTAAATCACCAGGAACTCGAGTTCCTGGTGATTTAATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015484
VALIDATED
SYF2 MISSION shRNA shRNA Plasmid DNA
SYF2 pre-mRNA-splicing factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-185s21c1
Sequence:CCGGCGGAATGAAGCTCGTAAATTACTCGAGTAATTTACGAGCTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015484.4-644s21c1
Sequence:CCGGAGCCGGAGACGTCCTTATAATCTCGAGATTATAAGGACGTCTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-926s21c1
Sequence:CCGGTGTGGTTTCTTAAACGTATATCTCGAGATATACGTTTAAGAAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-465s21c1
Sequence:CCGGGGTTGACCAAGCAGATCAAACCTCGAGGTTTGATCTGCTTGGTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-144s21c1
Sequence:CCGGGCGAACAGAGACTGCGCAAATCTCGAGATTTGCGCAGTCTCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015484.2-1064s1c1
Sequence:CCGGGCTGTTTAATCTTTGAAGCATCTCGAGATGCTTCAAAGATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-172s1c1
Sequence:CCGGTGCGGAATGAAGCTCGTAAATCTCGAGATTTACGAGCTTCATTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-173s1c1
Sequence:CCGGGCGGAATGAAGCTCGTAAATTCTCGAGAATTTACGAGCTTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-645s1c1
Sequence:CCGGCCTTATAATGATGATGCAGATCTCGAGATCTGCATCATCATTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-186s1c1
Sequence:CCGGCGTAAATTAAATCACCAGGAACTCGAGTTCCTGGTGATTTAATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015484
VALIDATED
SYF2 MISSION shRNA Lentiviral Transduction Particles
SYF2 pre-mRNA-splicing factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-185s21c1
Sequence:CCGGCGGAATGAAGCTCGTAAATTACTCGAGTAATTTACGAGCTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015484.4-644s21c1
Sequence:CCGGAGCCGGAGACGTCCTTATAATCTCGAGATTATAAGGACGTCTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-926s21c1
Sequence:CCGGTGTGGTTTCTTAAACGTATATCTCGAGATATACGTTTAAGAAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-465s21c1
Sequence:CCGGGGTTGACCAAGCAGATCAAACCTCGAGGTTTGATCTGCTTGGTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015484.4-144s21c1
Sequence:CCGGGCGAACAGAGACTGCGCAAATCTCGAGATTTGCGCAGTCTCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015484.2-1064s1c1
Sequence:CCGGGCTGTTTAATCTTTGAAGCATCTCGAGATGCTTCAAAGATTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-172s1c1
Sequence:CCGGTGCGGAATGAAGCTCGTAAATCTCGAGATTTACGAGCTTCATTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-173s1c1
Sequence:CCGGGCGGAATGAAGCTCGTAAATTCTCGAGAATTTACGAGCTTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-645s1c1
Sequence:CCGGCCTTATAATGATGATGCAGATCTCGAGATCTGCATCATCATTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015484.2-186s1c1
Sequence:CCGGCGTAAATTAAATCACCAGGAACTCGAGTTCCTGGTGATTTAATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026780
VALIDATED
SYF2 MISSION shRNA Bacterial Glycerol Stock
SYF2 pre-mRNA-splicing factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026780.3-788s21c1
Sequence:CCGGGGAGGCTTCTGCTGGCAAATTCTCGAGAATTTGCCAGCAGAAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-628s21c1
Sequence:CCGGGCCGACATCGACTACATCAATCTCGAGATTGATGTAGTCGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-536s21c1
Sequence:CCGGCCTCAGAGGAAATTGACAGAACTCGAGTTCTGTCAATTTCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-731s21c1
Sequence:CCGGGCACAGCTGTGTGAGCTTAAACTCGAGTTTAAGCTCACACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026780.1-929s1c1
Sequence:CCGGGCTTGGATAGACGATGTATTTCTCGAGAAATACATCGTCTATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-630s1c1
Sequence:CCGGGCCGACATCGACTACATCAATCTCGAGATTGATGTAGTCGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-538s1c1
Sequence:CCGGCCTCAGAGGAAATTGACAGAACTCGAGTTCTGTCAATTTCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-399s1c1
Sequence:CCGGGCTGCCCAATTACGCCAGTATCTCGAGATACTGGCGTAATTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-544s1c1
Sequence:CCGGAGGAAATTGACAGAATGGTTTCTCGAGAAACCATTCTGTCAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026780
VALIDATED
SYF2 MISSION shRNA shRNA Plasmid DNA
SYF2 pre-mRNA-splicing factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026780.3-788s21c1
Sequence:CCGGGGAGGCTTCTGCTGGCAAATTCTCGAGAATTTGCCAGCAGAAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-628s21c1
Sequence:CCGGGCCGACATCGACTACATCAATCTCGAGATTGATGTAGTCGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-536s21c1
Sequence:CCGGCCTCAGAGGAAATTGACAGAACTCGAGTTCTGTCAATTTCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-731s21c1
Sequence:CCGGGCACAGCTGTGTGAGCTTAAACTCGAGTTTAAGCTCACACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026780.1-929s1c1
Sequence:CCGGGCTTGGATAGACGATGTATTTCTCGAGAAATACATCGTCTATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-630s1c1
Sequence:CCGGGCCGACATCGACTACATCAATCTCGAGATTGATGTAGTCGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-538s1c1
Sequence:CCGGCCTCAGAGGAAATTGACAGAACTCGAGTTCTGTCAATTTCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-399s1c1
Sequence:CCGGGCTGCCCAATTACGCCAGTATCTCGAGATACTGGCGTAATTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-544s1c1
Sequence:CCGGAGGAAATTGACAGAATGGTTTCTCGAGAAACCATTCTGTCAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026780
VALIDATED
SYF2 MISSION shRNA Lentiviral Transduction Particles
SYF2 pre-mRNA-splicing factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026780.3-788s21c1
Sequence:CCGGGGAGGCTTCTGCTGGCAAATTCTCGAGAATTTGCCAGCAGAAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-628s21c1
Sequence:CCGGGCCGACATCGACTACATCAATCTCGAGATTGATGTAGTCGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-536s21c1
Sequence:CCGGCCTCAGAGGAAATTGACAGAACTCGAGTTCTGTCAATTTCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026780.3-731s21c1
Sequence:CCGGGCACAGCTGTGTGAGCTTAAACTCGAGTTTAAGCTCACACAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026780.1-929s1c1
Sequence:CCGGGCTTGGATAGACGATGTATTTCTCGAGAAATACATCGTCTATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-630s1c1
Sequence:CCGGGCCGACATCGACTACATCAATCTCGAGATTGATGTAGTCGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-538s1c1
Sequence:CCGGCCTCAGAGGAAATTGACAGAACTCGAGTTCTGTCAATTTCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-399s1c1
Sequence:CCGGGCTGCCCAATTACGCCAGTATCTCGAGATACTGGCGTAATTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026780.1-544s1c1
Sequence:CCGGAGGAAATTGACAGAATGGTTTCTCGAGAAACCATTCTGTCAATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks