EMAIL THIS PAGE TO A FRIEND

SYK

spleen tyrosine kinase

Synonyms: p72-Syk
UniProtKB ID: P43405
Gene ID:
Human(6850) Summary: This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(20963) spleen tyrosine kinase
Rat(25155) spleen tyrosine kinase
Zebrafish(405769) spleen tyrosine kinase
chicken(427272) spleen tyrosine kinase
domestic cat(101087013) spleen tyrosine kinase
Horse(100063383) spleen tyrosine kinase
dog(484196) spleen tyrosine kinase
cow(515515) spleen tyrosine kinase
sheep(101105303) spleen tyrosine kinase
domestic guinea pig(100716985) spleen tyrosine kinase
naked mole-rat(101719494) spleen tyrosine kinase
Domestic Rabbit(100345556) spleen tyrosine kinase
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302523 ANTI-MOUSE SYK (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300282 Anti-phospho-SYK (pTyr323) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503994 Anti-phospho-SYK (pTyr323) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4503838 Anti-phospho-SYK (pTyr348) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301384 Anti-phospho-SYK (pTyr352) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503839 Anti-phospho-SYK (pTyr525) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB2500987 Anti-Spleen tyrosine kinase/SYK antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, canine, rat
ELISA, western blot pricing
S6073 Anti-SYK (521-535) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
S6198 Anti-SYK (58-70) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300598 Anti-SYK (Ab-323) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
HPA001384 Anti-SYK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502899 Anti-SYK antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4502901 Anti-SYK antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing
SAB4502902 Anti-SYK antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4502900 Anti-SYK, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
WH0006850M1 Monoclonal Anti-SYK antibody produced in mouse clone 4A7, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
160369 Phenylmalonic acid 98% human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E2250 Ellagic acid ≥95% (HPLC), powder, from tree bark human, rat pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1048 MCF10A CELLS SYK (-/-) human pricing

ELISA

Product # Description Species Add to Cart
 
RAB0999 Phosphotyrosine SYK / Tyrosine-protein Kinase SYK ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003177 Rosetta Predictions human pricing
NM_012758 Rosetta Predictions rat pricing
NM_011518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224865 predicted 1940
2 SASI_Hs01_00224866 predicted 2105
3 SASI_Hs01_00224867 predicted 1588
4 SASI_Hs01_00224868 predicted 678
5 SASI_Hs01_00224869 predicted 699
6 SASI_Hs01_00224870 predicted 1629
7 SASI_Hs01_00224871 predicted 1372
8 SASI_Hs01_00224872 predicted 779
9 SASI_Hs01_00224873 predicted 876
10 SASI_Hs01_00224874 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069533 predicted 863
2 SASI_Rn02_00260121 predicted 1831
3 SASI_Rn01_00069534 predicted 2105
4 SASI_Rn01_00069535 predicted 477
5 SASI_Rn01_00069536 predicted 2092
6 SASI_Rn01_00069537 predicted 1927
7 SASI_Rn01_00069538 predicted 579
8 SASI_Rn01_00069539 predicted 2025
9 SASI_Rn01_00069540 predicted 1177
10 SASI_Rn01_00069542 predicted 472
11 SASI_Rn01_00069541 predicted 2266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190021 predicted 341
2 SASI_Mm01_00190022 predicted 1722
3 SASI_Mm01_00190023 predicted 373
4 SASI_Mm01_00190025 predicted 497
5 SASI_Mm02_00320836 predicted 723
6 SASI_Mm01_00190026 predicted 1590
7 SASI_Mm01_00190027 predicted 363
8 SASI_Mm01_00190028 predicted 801
9 SASI_Mm01_00190029 predicted 417
10 SASI_Mm01_00190030 predicted 1258
11 SASI_Mm01_00190024 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003177
VALIDATED
SYK MISSION shRNA Bacterial Glycerol Stock
spleen tyrosine kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-1004s1c1
Sequence:CCGGCGGGTGGAATAATCTCAAGAACTCGAGTTCTTGAGATTATTCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003177.x-2472s1c1
Sequence:CCGGCCTTAGCATGTGACTCCTGAACTCGAGTTCAGGAGTCACATGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003177.x-2025s1c1
Sequence:CCGGGCGCAATTACTACTATGACGTCTCGAGACGTCATAGTAGTAATTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-801s1c1
Sequence:CCGGCGACAAAGACAAGACAGGGAACTCGAGTTCCCTGTCTTGTCTTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-579s1c1
Sequence:CCGGGCAGGCCATCATCAGTCAGAACTCGAGTTCTGACTGATGATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-2181s1c1
Sequence:CCGGGCCCACAACTTGTCACCCAAACTCGAGTTTGGGTGACAAGTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-2506s1c1
Sequence:CCGGCAGAGGAATTTGGCTGCTTCTCTCGAGAGAAGCAGCCAAATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-245s1c1
Sequence:CCGGGCATGAGTGATGGGCTTTATTCTCGAGAATAAAGCCCATCACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-889s1c1
Sequence:CCGGGCAGATGGTTTGTTAAGAGTTCTCGAGAACTCTTAACAAACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-1527s1c1
Sequence:CCGGGCAGCAGAACAGACATGTCAACTCGAGTTGACATGTCTGTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003177.3-2342s1c1
Sequence:CCGGCAAATCCCTTTCATGTCTTTCCTCGAGGAAAGACATGAAAGGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-947s21c1
Sequence:CCGGGCAGATGGTTTGTTAAGAGTTCTCGAGAACTCTTAACAAACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-637s21c1
Sequence:CCGGGCAGGCCATCATCAGTCAGAACTCGAGTTCTGACTGATGATGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-303s21c1
Sequence:CCGGGCATGAGTGATGGGCTTTATTCTCGAGAATAAAGCCCATCACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-1585s21c1
Sequence:CCGGGCAGCAGAACAGACATGTCAACTCGAGTTGACATGTCTGTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003177
VALIDATED
SYK MISSION shRNA shRNA Plasmid DNA
spleen tyrosine kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-1004s1c1
Sequence:CCGGCGGGTGGAATAATCTCAAGAACTCGAGTTCTTGAGATTATTCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003177.x-2472s1c1
Sequence:CCGGCCTTAGCATGTGACTCCTGAACTCGAGTTCAGGAGTCACATGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003177.x-2025s1c1
Sequence:CCGGGCGCAATTACTACTATGACGTCTCGAGACGTCATAGTAGTAATTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-801s1c1
Sequence:CCGGCGACAAAGACAAGACAGGGAACTCGAGTTCCCTGTCTTGTCTTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-579s1c1
Sequence:CCGGGCAGGCCATCATCAGTCAGAACTCGAGTTCTGACTGATGATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-2181s1c1
Sequence:CCGGGCCCACAACTTGTCACCCAAACTCGAGTTTGGGTGACAAGTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-2506s1c1
Sequence:CCGGCAGAGGAATTTGGCTGCTTCTCTCGAGAGAAGCAGCCAAATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-245s1c1
Sequence:CCGGGCATGAGTGATGGGCTTTATTCTCGAGAATAAAGCCCATCACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-889s1c1
Sequence:CCGGGCAGATGGTTTGTTAAGAGTTCTCGAGAACTCTTAACAAACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-1527s1c1
Sequence:CCGGGCAGCAGAACAGACATGTCAACTCGAGTTGACATGTCTGTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003177.3-2342s1c1
Sequence:CCGGCAAATCCCTTTCATGTCTTTCCTCGAGGAAAGACATGAAAGGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-947s21c1
Sequence:CCGGGCAGATGGTTTGTTAAGAGTTCTCGAGAACTCTTAACAAACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-637s21c1
Sequence:CCGGGCAGGCCATCATCAGTCAGAACTCGAGTTCTGACTGATGATGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-303s21c1
Sequence:CCGGGCATGAGTGATGGGCTTTATTCTCGAGAATAAAGCCCATCACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-1585s21c1
Sequence:CCGGGCAGCAGAACAGACATGTCAACTCGAGTTGACATGTCTGTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003177
VALIDATED
SYK MISSION shRNA Lentiviral Transduction Particles
spleen tyrosine kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-1004s1c1
Sequence:CCGGCGGGTGGAATAATCTCAAGAACTCGAGTTCTTGAGATTATTCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003167    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003177.x-2472s1c1
Sequence:CCGGCCTTAGCATGTGACTCCTGAACTCGAGTTCAGGAGTCACATGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003177.x-2025s1c1
Sequence:CCGGGCGCAATTACTACTATGACGTCTCGAGACGTCATAGTAGTAATTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-801s1c1
Sequence:CCGGCGACAAAGACAAGACAGGGAACTCGAGTTCCCTGTCTTGTCTTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.x-579s1c1
Sequence:CCGGGCAGGCCATCATCAGTCAGAACTCGAGTTCTGACTGATGATGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-2181s1c1
Sequence:CCGGGCCCACAACTTGTCACCCAAACTCGAGTTTGGGTGACAAGTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-2506s1c1
Sequence:CCGGCAGAGGAATTTGGCTGCTTCTCTCGAGAGAAGCAGCCAAATTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-245s1c1
Sequence:CCGGGCATGAGTGATGGGCTTTATTCTCGAGAATAAAGCCCATCACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-889s1c1
Sequence:CCGGGCAGATGGTTTGTTAAGAGTTCTCGAGAACTCTTAACAAACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003177.3-1527s1c1
Sequence:CCGGGCAGCAGAACAGACATGTCAACTCGAGTTGACATGTCTGTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003177.3-2342s1c1
Sequence:CCGGCAAATCCCTTTCATGTCTTTCCTCGAGGAAAGACATGAAAGGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-947s21c1
Sequence:CCGGGCAGATGGTTTGTTAAGAGTTCTCGAGAACTCTTAACAAACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-637s21c1
Sequence:CCGGGCAGGCCATCATCAGTCAGAACTCGAGTTCTGACTGATGATGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-303s21c1
Sequence:CCGGGCATGAGTGATGGGCTTTATTCTCGAGAATAAAGCCCATCACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003177.4-1585s21c1
Sequence:CCGGGCAGCAGAACAGACATGTCAACTCGAGTTGACATGTCTGTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011518
SYK MISSION shRNA Bacterial Glycerol Stock
spleen tyrosine kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1836s1c1
Sequence:CCGGGCAGCAGAACAGGCACATTAACTCGAGTTAATGTGCCTGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1101s1c1
Sequence:CCGGCGAAGGGAAAGTATTGCACTACTCGAGTAGTGCAATACTTTCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-2250s1c1
Sequence:CCGGGAGAGAGATGTACGACCTGATCTCGAGATCAGGTCGTACATCTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1191s1c1
Sequence:CCGGGCTAGTGGAACATTACTCTTACTCGAGTAAGAGTAATGTTCCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-675s1c1
Sequence:CCGGGAGGGAACTTAATGGCACCTACTCGAGTAGGTGCCATTAAGTTCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011518.2-4600s21c1
Sequence:CCGGGACTATGAATGCCCACTAAATCTCGAGATTTAGTGGGCATTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-2087s21c1
Sequence:CCGGACTACGACGTGGTTAACTAACCTCGAGGTTAGTTAACCACGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-2064s21c1
Sequence:CCGGGGAACTGAGGCTTCGCAATTACTCGAGTAATTGCGAAGCCTCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-1061s21c1
Sequence:CCGGGAATAATCTCAAGGATCAAATCTCGAGATTTGATCCTTGAGATTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-754s21c1
Sequence:CCGGACGGTCCTCATAGGGTCAAAGCTCGAGCTTTGACCCTATGAGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011518
SYK MISSION shRNA shRNA Plasmid DNA
spleen tyrosine kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1836s1c1
Sequence:CCGGGCAGCAGAACAGGCACATTAACTCGAGTTAATGTGCCTGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1101s1c1
Sequence:CCGGCGAAGGGAAAGTATTGCACTACTCGAGTAGTGCAATACTTTCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-2250s1c1
Sequence:CCGGGAGAGAGATGTACGACCTGATCTCGAGATCAGGTCGTACATCTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1191s1c1
Sequence:CCGGGCTAGTGGAACATTACTCTTACTCGAGTAAGAGTAATGTTCCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-675s1c1
Sequence:CCGGGAGGGAACTTAATGGCACCTACTCGAGTAGGTGCCATTAAGTTCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011518.2-4600s21c1
Sequence:CCGGGACTATGAATGCCCACTAAATCTCGAGATTTAGTGGGCATTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-2087s21c1
Sequence:CCGGACTACGACGTGGTTAACTAACCTCGAGGTTAGTTAACCACGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-2064s21c1
Sequence:CCGGGGAACTGAGGCTTCGCAATTACTCGAGTAATTGCGAAGCCTCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-1061s21c1
Sequence:CCGGGAATAATCTCAAGGATCAAATCTCGAGATTTGATCCTTGAGATTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-754s21c1
Sequence:CCGGACGGTCCTCATAGGGTCAAAGCTCGAGCTTTGACCCTATGAGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011518
SYK MISSION shRNA Lentiviral Transduction Particles
spleen tyrosine kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1836s1c1
Sequence:CCGGGCAGCAGAACAGGCACATTAACTCGAGTTAATGTGCCTGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1101s1c1
Sequence:CCGGCGAAGGGAAAGTATTGCACTACTCGAGTAGTGCAATACTTTCCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-2250s1c1
Sequence:CCGGGAGAGAGATGTACGACCTGATCTCGAGATCAGGTCGTACATCTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-1191s1c1
Sequence:CCGGGCTAGTGGAACATTACTCTTACTCGAGTAAGAGTAATGTTCCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011518.1-675s1c1
Sequence:CCGGGAGGGAACTTAATGGCACCTACTCGAGTAGGTGCCATTAAGTTCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011518.2-4600s21c1
Sequence:CCGGGACTATGAATGCCCACTAAATCTCGAGATTTAGTGGGCATTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-2087s21c1
Sequence:CCGGACTACGACGTGGTTAACTAACCTCGAGGTTAGTTAACCACGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-2064s21c1
Sequence:CCGGGGAACTGAGGCTTCGCAATTACTCGAGTAATTGCGAAGCCTCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-1061s21c1
Sequence:CCGGGAATAATCTCAAGGATCAAATCTCGAGATTTGATCCTTGAGATTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011518.2-754s21c1
Sequence:CCGGACGGTCCTCATAGGGTCAAAGCTCGAGCTTTGACCCTATGAGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks