EMAIL THIS PAGE TO A FRIEND

SYMPK

symplekin

Synonyms: SPK SYM
UniProtKB ID: Q92797, O00521, O00689, O00733, Q59GT5, Q8N2U5
Gene ID:
Human(8189) Summary: This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
Mouse(68188) symplekin
Rat(292683) symplekin
Horse(100070949) symplekin
dog(476431) symplekin
cow(100337373) symplekin
sheep(101119155) symplekin
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004819 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004819 Rosetta Predictions human pricing
XM_001075350 Rosetta Predictions rat pricing
XM_214843 Rosetta Predictions rat pricing
XM_485873 Rosetta Predictions mouse pricing
XM_905076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161512 predicted 2021
2 SASI_Hs02_00338378 predicted 547
3 SASI_Hs01_00161515 predicted 1914
4 SASI_Hs01_00161516 predicted 2963
5 SASI_Hs02_00338379 predicted 2291
6 SASI_Hs01_00161517 predicted 2491
7 SASI_Hs02_00338380 predicted 3502
8 SASI_Hs01_00161518 predicted 1706
9 SASI_Hs02_00338381 predicted 1252
10 SASI_Hs01_00161520 predicted 1105
11 SASI_Hs01_00161511 predicted 3330
12 SASI_Hs01_00161513 predicted 2938
13 SASI_Hs01_00161514 predicted 1281
14 SASI_Hs01_00161519 predicted 2416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349438 predicted 1930
2 SASI_Rn02_00349439 predicted 1876
3 SASI_Rn02_00349440 predicted 1262
4 SASI_Rn02_00349441 predicted 1475
5 SASI_Rn02_00349442 predicted 1437
6 SASI_Rn02_00349443 predicted 1710
7 SASI_Rn02_00349444 predicted 805
8 SASI_Rn02_00349445 predicted 2033
9 SASI_Rn02_00349446 predicted 791
10 SASI_Rn02_00349447 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375617 predicted 1927
2 SASI_Rn02_00375618 predicted 2611
3 SASI_Rn02_00375619 predicted 1873
4 SASI_Rn02_00375620 predicted 1265
5 SASI_Rn02_00375621 predicted 1471
6 SASI_Rn02_00375622 predicted 1439
7 SASI_Rn02_00375623 predicted 1717
8 SASI_Rn02_00375624 predicted 807
9 SASI_Rn02_00375625 predicted 2029
10 SASI_Rn02_00375626 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426742 predicted 1235
2 SASI_Mm01_00270378 predicted 2151
3 SASI_Mm01_00270379 predicted 1325
4 SASI_Mm01_00270380 predicted 2159
5 SASI_Mm02_00426743 predicted 1233
6 SASI_Mm01_00270381 predicted 3013
7 SASI_Mm01_00270382 predicted 1185
8 SASI_Mm01_00270383 predicted 2860
9 SASI_Mm01_00270385 predicted 1960
10 SASI_Mm01_00270386 predicted 2829
11 SASI_Mm01_00270384 predicted 3329
12 SASI_Mm01_00270387 predicted 2077
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431448 predicted 1229
2 SASI_Mm02_00431449 predicted 432
3 SASI_Mm02_00431450 predicted 2150
4 SASI_Mm02_00431451 predicted 2157
5 SASI_Mm02_00431452 predicted 299
6 SASI_Mm02_00431453 predicted 3014
7 SASI_Mm02_00431454 predicted 1181
8 SASI_Mm02_00431455 predicted 305
9 SASI_Mm02_00431456 predicted 314
10 SASI_Mm02_00431457 predicted 1953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026605
VALIDATED
SYMPK MISSION shRNA Bacterial Glycerol Stock
symplekin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2985s21c1
Sequence:CCGGCTGATTGCATTGCACAATATTCTCGAGAATATTGTGCAATGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2013s21c1
Sequence:CCGGTGGCTCTACCAGGAATATAATCTCGAGATTATATTCCTGGTAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2383s21c1
Sequence:CCGGTTCGAGAGTATGTGGAGAAATCTCGAGATTTCTCCACATACTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2055s21c1
Sequence:CCGGTCAGGCACTCTGGACAAATATCTCGAGATATTTGTCCAGAGTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2338s21c1
Sequence:CCGGCCCAGGCCTTGCTCTTCATTACTCGAGTAATGAAGAGCAAGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026605
VALIDATED
SYMPK MISSION shRNA shRNA Plasmid DNA
symplekin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2985s21c1
Sequence:CCGGCTGATTGCATTGCACAATATTCTCGAGAATATTGTGCAATGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2013s21c1
Sequence:CCGGTGGCTCTACCAGGAATATAATCTCGAGATTATATTCCTGGTAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2383s21c1
Sequence:CCGGTTCGAGAGTATGTGGAGAAATCTCGAGATTTCTCCACATACTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2055s21c1
Sequence:CCGGTCAGGCACTCTGGACAAATATCTCGAGATATTTGTCCAGAGTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2338s21c1
Sequence:CCGGCCCAGGCCTTGCTCTTCATTACTCGAGTAATGAAGAGCAAGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026605
VALIDATED
SYMPK MISSION shRNA Lentiviral Transduction Particles
symplekin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2985s21c1
Sequence:CCGGCTGATTGCATTGCACAATATTCTCGAGAATATTGTGCAATGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2013s21c1
Sequence:CCGGTGGCTCTACCAGGAATATAATCTCGAGATTATATTCCTGGTAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2383s21c1
Sequence:CCGGTTCGAGAGTATGTGGAGAAATCTCGAGATTTCTCCACATACTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2055s21c1
Sequence:CCGGTCAGGCACTCTGGACAAATATCTCGAGATATTTGTCCAGAGTGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026605.2-2338s21c1
Sequence:CCGGCCCAGGCCTTGCTCTTCATTACTCGAGTAATGAAGAGCAAGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004819
VALIDATED
SYMPK MISSION shRNA Bacterial Glycerol Stock
symplekin
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004819.1-2784s1c1
Sequence:CCGGGCCTAAACTCATCAAACTCAACTCGAGTTGAGTTTGATGAGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-867s1c1
Sequence:CCGGCATGTTCATGTCTGAGGTGATCTCGAGATCACCTCAGACATGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-2262s1c1
Sequence:CCGGGCTGTTCATCAAACGCATGTACTCGAGTACATGCGTTTGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-2898s1c1
Sequence:CCGGCCTGATCGCATTACACAACATCTCGAGATGTTGTGTAATGCGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004819.1-960s1c1
Sequence:CCGGGAATCTGAAGCTGCACCTGTTCTCGAGAACAGGTGCAGCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-2808s1c1
Sequence:CCGGCATCGTGGTGAAGGAAGTCTTCTCGAGAAGACTTCCTTCACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-733s1c1
Sequence:CCGGCAGTACAACGTGCTATGGGAACTCGAGTTCCCATAGCACGTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-2259s1c1
Sequence:CCGGCCTGCTGTTCATCAAACGCATCTCGAGATGCGTTTGATGAACAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004819.1-777s1c1
Sequence:CCGGGCTGCTTAAGTTCATGGTGCACTCGAGTGCACCATGAACTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-943s1c1
Sequence:CCGGGTGAGCAGTGTGCGTAAGAATCTCGAGATTCTTACGCACACTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-1281s1c1
Sequence:CCGGGACGCCTGATAATGTGGCTAACTCGAGTTAGCCACATTATCAGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-492s1c1
Sequence:CCGGGATGGTAAAGTCACGGGTAATCTCGAGATTACCCGTGACTTTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004819
VALIDATED
SYMPK MISSION shRNA shRNA Plasmid DNA
symplekin
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004819.1-2784s1c1
Sequence:CCGGGCCTAAACTCATCAAACTCAACTCGAGTTGAGTTTGATGAGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-867s1c1
Sequence:CCGGCATGTTCATGTCTGAGGTGATCTCGAGATCACCTCAGACATGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-2262s1c1
Sequence:CCGGGCTGTTCATCAAACGCATGTACTCGAGTACATGCGTTTGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-2898s1c1
Sequence:CCGGCCTGATCGCATTACACAACATCTCGAGATGTTGTGTAATGCGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004819.1-960s1c1
Sequence:CCGGGAATCTGAAGCTGCACCTGTTCTCGAGAACAGGTGCAGCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-2808s1c1
Sequence:CCGGCATCGTGGTGAAGGAAGTCTTCTCGAGAAGACTTCCTTCACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-733s1c1
Sequence:CCGGCAGTACAACGTGCTATGGGAACTCGAGTTCCCATAGCACGTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-2259s1c1
Sequence:CCGGCCTGCTGTTCATCAAACGCATCTCGAGATGCGTTTGATGAACAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004819.1-777s1c1
Sequence:CCGGGCTGCTTAAGTTCATGGTGCACTCGAGTGCACCATGAACTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-943s1c1
Sequence:CCGGGTGAGCAGTGTGCGTAAGAATCTCGAGATTCTTACGCACACTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-1281s1c1
Sequence:CCGGGACGCCTGATAATGTGGCTAACTCGAGTTAGCCACATTATCAGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-492s1c1
Sequence:CCGGGATGGTAAAGTCACGGGTAATCTCGAGATTACCCGTGACTTTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004819
VALIDATED
SYMPK MISSION shRNA Lentiviral Transduction Particles
symplekin
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004819.1-2784s1c1
Sequence:CCGGGCCTAAACTCATCAAACTCAACTCGAGTTGAGTTTGATGAGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-867s1c1
Sequence:CCGGCATGTTCATGTCTGAGGTGATCTCGAGATCACCTCAGACATGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-2262s1c1
Sequence:CCGGGCTGTTCATCAAACGCATGTACTCGAGTACATGCGTTTGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-2898s1c1
Sequence:CCGGCCTGATCGCATTACACAACATCTCGAGATGTTGTGTAATGCGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004819.1-960s1c1
Sequence:CCGGGAATCTGAAGCTGCACCTGTTCTCGAGAACAGGTGCAGCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-2808s1c1
Sequence:CCGGCATCGTGGTGAAGGAAGTCTTCTCGAGAAGACTTCCTTCACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-733s1c1
Sequence:CCGGCAGTACAACGTGCTATGGGAACTCGAGTTCCCATAGCACGTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-2259s1c1
Sequence:CCGGCCTGCTGTTCATCAAACGCATCTCGAGATGCGTTTGATGAACAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004819.1-777s1c1
Sequence:CCGGGCTGCTTAAGTTCATGGTGCACTCGAGTGCACCATGAACTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-943s1c1
Sequence:CCGGGTGAGCAGTGTGCGTAAGAATCTCGAGATTCTTACGCACACTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004819.1-1281s1c1
Sequence:CCGGGACGCCTGATAATGTGGCTAACTCGAGTTAGCCACATTATCAGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004819.1-492s1c1
Sequence:CCGGGATGGTAAAGTCACGGGTAATCTCGAGATTACCCGTGACTTTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks