EMAIL THIS PAGE TO A FRIEND

SYN1

synapsin I

Synonyms: SYN1a SYN1b SYNI
UniProtKB ID: P17600, B1AJQ1, O75825, Q5H9A9
Gene ID:
Human(6853) Summary: This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family plays a role in regulation of axonogenesis and synaptogenesis. The protein encoded serves as a substrate for several different protein kinases and phosphorylation may function in the regulation of this protein in the nerve terminal. Mutations in this gene may be associated with X-linked disorders with primary neuronal degeneration such as Rett syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(20964) synapsin I
Rat(24949) synapsin I
fruit fly(40424) Syntrophin-like 1
Zebrafish(570672) synapsin I
dog(491858) synapsin I
dog(100685486) synapsin I
Thale Cress(830432) RAD21-like protein SYN1
cow(281510) synapsin I
sheep(101114245) synapsin I
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300634 Anti-phospho-Syn1 (pSer549) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4300212 Anti-phospho-SYN1 (pSer9) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, western blot pricing
SAB4504550 Anti-phospho-Synapsin (pSer9) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
S8192 Anti-phospho-Synapsin I (pSer603) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution Xenopus, human, bovine, mouse, zebrafish, rat
western blot pricing
S8067 Anti-phospho-Synapsin I (pSer9) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human, Xenopus, chicken
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504214 Anti-phospho-Synapsin1 (pSer605) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4503995 Anti-phospho-Synapsin1 (pSer62) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300513 Anti-SYN1 (Ab-9) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB1412138 ANTI-SYN1 antibody produced in mouse clone 3F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412425 ANTI-SYN1 antibody produced in mouse clone 3H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412529 ANTI-SYN1 antibody produced in mouse clone 3E3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412557 ANTI-SYN1 antibody produced in mouse clone 1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA000397 Anti-SYN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
S193 Anti-Synapsin I antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, human, rat, bovine
dot blot, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4502905 Anti-Synapsin, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4502904 Anti-Synapsin1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry pricing
SAB4502903 Anti-Synapsin1, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
WH0006853M7 Monoclonal Anti-SYN1 antibody produced in mouse clone 4H1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404432 Monoclonal Anti-SYN1 antibody produced in mouse clone 4F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073101 MISSION® esiRNA esiRNA human SYN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006950 Rosetta Predictions human pricing
NM_133499 Rosetta Predictions human pricing
NM_001110782 Rosetta Predictions rat pricing
NM_019133 Rosetta Predictions rat pricing
NM_001110780 Rosetta Predictions mouse pricing
NM_013680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159243 predicted 845
2 SASI_Hs01_00159244 predicted 560
3 SASI_Hs01_00159245 predicted 777
4 SASI_Hs01_00159246 predicted 708
5 SASI_Hs01_00159247 predicted 890
6 SASI_Hs01_00159248 predicted 1161
7 SASI_Hs01_00159249 predicted 1038
8 SASI_Hs01_00159250 predicted 783
9 SASI_Hs01_00159251 predicted 2473
10 SASI_Hs01_00159252 predicted 2655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154131 predicted 858
2 SASI_Hs01_00154132 predicted 844
3 SASI_Hs01_00154133 predicted 562
4 SASI_Hs01_00154134 predicted 707
5 SASI_Hs01_00154135 predicted 896
6 SASI_Hs01_00154136 predicted 1164
7 SASI_Hs02_00363228 predicted 774
8 SASI_Hs01_00154137 predicted 2434
9 SASI_Hs01_00154138 predicted 716
10 SASI_Hs02_00363229 predicted 2379
11 SASI_Hs01_00154139 predicted 2535
12 SASI_Hs01_00154140 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251322 predicted 966
2 SASI_Rn02_00251323 predicted 484
3 SASI_Rn02_00251324 predicted 855
4 SASI_Rn02_00251325 predicted 808
5 SASI_Rn02_00251326 predicted 563
6 SASI_Rn02_00251327 predicted 949
7 SASI_Rn02_00251328 predicted 801
8 SASI_Rn02_00251329 predicted 826
9 SASI_Rn02_00251330 predicted 709
10 SASI_Rn02_00251331 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060481 predicted 963
2 SASI_Rn01_00060483 predicted 489
3 SASI_Rn01_00060484 predicted 853
4 SASI_Rn02_00261877 predicted 808
5 SASI_Rn01_00060485 predicted 566
6 SASI_Rn01_00060486 predicted 955
7 SASI_Rn01_00060487 predicted 796
8 SASI_Rn02_00261878 predicted 824
9 SASI_Rn02_00261879 predicted 711
10 SASI_Rn01_00060489 predicted 660
11 SASI_Rn01_00060482 predicted 938
12 SASI_Rn01_00060488 predicted 681
13 SASI_Rn01_00060490 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305698 predicted 871
2 SASI_Mm02_00305699 predicted 941
3 SASI_Mm02_00305700 predicted 616
4 SASI_Mm02_00305701 predicted 1042
5 SASI_Mm02_00305702 predicted 1305
6 SASI_Mm02_00305703 predicted 760
7 SASI_Mm02_00305704 predicted 909
8 SASI_Mm02_00305705 predicted 997
9 SASI_Mm02_00305706 predicted 802
10 SASI_Mm02_00305707 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165914 predicted 874
2 SASI_Mm01_00165916 predicted 941
3 SASI_Mm01_00165917 predicted 614
4 SASI_Mm01_00165918 predicted 1037
5 SASI_Mm01_00165919 predicted 1302
6 SASI_Mm01_00165920 predicted 756
7 SASI_Mm01_00165921 predicted 904
8 SASI_Mm01_00165922 predicted 1001
9 SASI_Mm02_00322546 predicted 801
10 SASI_Mm02_00322547 predicted 703
11 SASI_Mm01_00165915 predicted 516
12 SASI_Mm01_00165923 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006950
SYN1 MISSION shRNA Bacterial Glycerol Stock
synapsin I
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-175s1c1
Sequence:CCGGCAATCTGCCAAATGGGTACATCTCGAGATGTACCCATTTGGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-1331s1c1
Sequence:CCGGGAAGACAAACAGCTCATCGTACTCGAGTACGATGAGCTGTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-775s1c1
Sequence:CCGGCTTGCATTCTGTCTACAACTTCTCGAGAAGTTGTAGACAGAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-888s1c1
Sequence:CCGGCCAATCACAAAGAAATGCTCACTCGAGTGAGCATTTCTTTGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-620s1c1
Sequence:CCGGGATATGGAAGTTCTTCGGAATCTCGAGATTCCGAAGAACTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006950
SYN1 MISSION shRNA shRNA Plasmid DNA
synapsin I
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-175s1c1
Sequence:CCGGCAATCTGCCAAATGGGTACATCTCGAGATGTACCCATTTGGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-1331s1c1
Sequence:CCGGGAAGACAAACAGCTCATCGTACTCGAGTACGATGAGCTGTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-775s1c1
Sequence:CCGGCTTGCATTCTGTCTACAACTTCTCGAGAAGTTGTAGACAGAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-888s1c1
Sequence:CCGGCCAATCACAAAGAAATGCTCACTCGAGTGAGCATTTCTTTGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-620s1c1
Sequence:CCGGGATATGGAAGTTCTTCGGAATCTCGAGATTCCGAAGAACTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006950
SYN1 MISSION shRNA Lentiviral Transduction Particles
synapsin I
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-175s1c1
Sequence:CCGGCAATCTGCCAAATGGGTACATCTCGAGATGTACCCATTTGGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-1331s1c1
Sequence:CCGGGAAGACAAACAGCTCATCGTACTCGAGTACGATGAGCTGTTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-775s1c1
Sequence:CCGGCTTGCATTCTGTCTACAACTTCTCGAGAAGTTGTAGACAGAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-888s1c1
Sequence:CCGGCCAATCACAAAGAAATGCTCACTCGAGTGAGCATTTCTTTGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006950.2-620s1c1
Sequence:CCGGGATATGGAAGTTCTTCGGAATCTCGAGATTCCGAAGAACTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013680
SYN1 MISSION shRNA Bacterial Glycerol Stock
synapsin I
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013680.3-2273s1c1
Sequence:CCGGCCTCAGTATGTCCCTTGAGAACTCGAGTTCTCAAGGGACATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-739s1c1
Sequence:CCGGCCAGTGTAAACTCTTTGCATTCTCGAGAATGCAAAGAGTTTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-685s1c1
Sequence:CCGGCACGTAATGGAGACTACCGAACTCGAGTTCGGTAGTCTCCATTACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-849s1c1
Sequence:CCGGGATCAGACTTTCTATCCTAATCTCGAGATTAGGATAGAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-1023s1c1
Sequence:CCGGCCCTTCATTGATGCTAAATATCTCGAGATATTTAGCATCAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013680
SYN1 MISSION shRNA shRNA Plasmid DNA
synapsin I
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013680.3-2273s1c1
Sequence:CCGGCCTCAGTATGTCCCTTGAGAACTCGAGTTCTCAAGGGACATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-739s1c1
Sequence:CCGGCCAGTGTAAACTCTTTGCATTCTCGAGAATGCAAAGAGTTTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-685s1c1
Sequence:CCGGCACGTAATGGAGACTACCGAACTCGAGTTCGGTAGTCTCCATTACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-849s1c1
Sequence:CCGGGATCAGACTTTCTATCCTAATCTCGAGATTAGGATAGAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-1023s1c1
Sequence:CCGGCCCTTCATTGATGCTAAATATCTCGAGATATTTAGCATCAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013680
SYN1 MISSION shRNA Lentiviral Transduction Particles
synapsin I
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013680.3-2273s1c1
Sequence:CCGGCCTCAGTATGTCCCTTGAGAACTCGAGTTCTCAAGGGACATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-739s1c1
Sequence:CCGGCCAGTGTAAACTCTTTGCATTCTCGAGAATGCAAAGAGTTTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-685s1c1
Sequence:CCGGCACGTAATGGAGACTACCGAACTCGAGTTCGGTAGTCTCCATTACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-849s1c1
Sequence:CCGGGATCAGACTTTCTATCCTAATCTCGAGATTAGGATAGAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013680.3-1023s1c1
Sequence:CCGGCCCTTCATTGATGCTAAATATCTCGAGATATTTAGCATCAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks